Electrochemically Driven Luminescence in Organometallic and Inorganic Systems

Fiorani, Andrea; Valenti, G.; Villani, Elena; Marcaccio, Massimo; Rampazzo, Enrico; Prodi, Luca; Paolucci, Francesco

doi:10.1007/978-3-319-49137-0_9

Cited by 6 publications

(2 citation statements)

References 112 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The choice of emitting species in ECL comprises a wide variety of systems ranging from organic to inorganic compounds [11,12], carbon nanomaterials [13], quantum dots [14], nanoparticles [15], and their assemblies. Nevertheless, ruthenium complexes, luminol, and their derivatives are the most employed luminophores for cell analysis due to their high luminescence efficiency, solubility in an aqueous medium, and the ability to achieve efficient ECL emission at a physiological pH.…”

Section: Luminophores For Cellular Analysismentioning

confidence: 99%

Recent Advances in Electrochemiluminescence-Based Systems for Mammalian Cell Analysis

et al. 2020

Self Cite

View full text Add to dashboard Cite

Mammalian cell analysis is essential in the context of both fundamental studies and clinical applications. Among the various techniques available for cell analysis, electrochemiluminescence (ECL) has attracted significant attention due to its integration of both electrochemical and spectroscopic methods. In this review, we summarize recent advances in the ECL-based systems developed for mammalian cell analysis. The review begins with a summary of the developments in luminophores that opened the door to ECL applications for biological samples. Secondly, ECL-based imaging systems are introduced as an emerging technique to visualize single-cell morphologies and intracellular molecules. In the subsequent section, the ECL sensors developed in the past decade are summarized, the use of which made the highly sensitive detection of cell-derived molecules possible. Although ECL immunoassays are well developed in terms of commercial use, the sensing of biomolecules at a single-cell level remains a challenge. Emphasis is therefore placed on ECL sensors that directly detect cellular molecules from small portions of cells or even single cells. Finally, the development of bipolar electrode devices for ECL cell assays is introduced. To conclude, the direction of research in this field and its application prospects are described.

show abstract

Section: Luminophores For Cellular Analysismentioning

confidence: 99%

Recent Advances in Electrochemiluminescence-Based Systems for Mammalian Cell Analysis

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…Metal complexes, especially [Ru(bpy) 3 ] 2+ and its analogues, are a class of important ECL luminophores, showing facile modulation in structures and associated ECL features. 6 In order to improve ECL efficiency and/or modulate ECL emission color, one of the effective approaches is to synthesize a multimetallic complex in which several of the same/different metal ions [e.g. Ru(II), Ir(III), Os(II), Pt(II)] are connected by a bridging ligand, forming the corresponding homometallic/ heterometallic complex.…”

mentioning

confidence: 99%

Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect

et al. 2019

View full text Add to dashboard Cite

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6 – = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH– ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

show abstract