Development of Primer-Probe Energy Transfer real-time PCR for the detection and quantification of porcine circovirus type 2

Bálint, Ádám; Tenk, M.; Deim, Zoltán; Rasmussen, Thomas Bruun; Uttenthal, Åse; Cságola, Attila; Tuboly, Tamás; Farsang, Attila; Fossum, Caroline; Timmusk, Salme; Berg, Mikael; Belák, Sándór

doi:10.1556/avet.57.2009.3.10

Cited by 9 publications

(3 citation statements)

References 27 publications

(32 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…DNA from 200 µL blood collected with EDTA as additive was extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany), eluted in 100 µL elution buffer and the concentration and purity was determined by spectrophotometry (Nanodrop 8000). The undiluted DNA was screened using a universal PCV2 assay (F: TAATTTTGCAGACCCGGAAAC; R: AGTAGATCATCCCACGGCAG) against the ORF1 reading frame [33] and the QuantiTect SYBR Green PCR Kit (Qiagen) as described above (56 °C annealing temperature; 96% efficiency). The presence of PCR inhibitors was evaluated by spiking selected negative samples with 2 × 10 5 copies of PCV2 DNA before analysis.…”

Section: Methodsmentioning

confidence: 99%

Innate immune responses induced by the saponin adjuvant Matrix-M in specific pathogen free pigs

Ahlberg

Hjertner

Wallgren

et al. 2017

Vet Res

Self Cite

View full text Add to dashboard Cite

Saponin-based adjuvants have been widely used to enhance humoral and cellular immune responses in many species, but their mode of action is not fully understood. A characterization of the porcine transcriptional response to Matrix-M was performed in vitro using lymphocytes, monocytes or monocyte-derived dendritic cells (MoDCs) and in vivo. The effect of Matrix-M was also evaluated in specific pathogen free (SPF) pigs exposed to conventionally reared pigs. The pro-inflammatory cytokine genes IL1B and CXCL8 were up-regulated in monocytes and lymphocytes after Matrix-M exposure. Matrix-M also induced IL12B, IL17A and IFNG in lymphocytes and IFN-α gene expression in MoDCs. Several genes were indicated as up-regulated by Matrix-M in blood 18 h after injection, of which the genes for IFN-α and TLR2 could be statistically confirmed. Respiratory disease developed in all SPF pigs mixed with conventional pigs within 1–3 days. Two out of four SPF pigs injected with saline prior to contact exposure displayed systemic symptoms that was not recorded for the four pigs administered Matrix-M. Granulocyte counts, serum amyloid A levels and transcription of IL18 and TLR2 coincided with disease progression in the pigs. These results support further evaluation of Matrix-M as a possible enhancer of innate immune responses during critical moments in pig management.Electronic supplementary materialThe online version of this article (doi:10.1186/s13567-017-0437-2) contains supplementary material, which is available to authorized users.

show abstract

Section: Methodsmentioning

confidence: 99%

Innate immune responses induced by the saponin adjuvant Matrix-M in specific pathogen free pigs

Ahlberg

Hjertner

Wallgren

et al. 2017

Vet Res

Self Cite

View full text Add to dashboard Cite

show abstract

“…The method can make use of either polyclonal, monoclonal, or a combination of both antibodies. Example: SARS COV-2 can be diagnosed by this method (Figure 33) [75].…”

Section: Proximity Ligation Assay (Pla)mentioning

confidence: 99%

Trends of Diagnostic Methods for Human Viral Diseases

Borkakoty,

Jakharia,

Singh

et al. 2024

Infectious Diseases

View full text Add to dashboard Cite

The global health field is significantly affected by viral infections, and sero-diagnosis is crucial in diagnostic virology. Various laboratory techniques such as nucleic acid detection, viral culture, and antigen detection are essential for diagnosing viral infections. Advances in science have led to the development of new immunologic and molecular techniques, enabling rapid and simplified diagnosis of different viruses. Timely and accurate identification of viral infections is vital for effective outbreak management. Immunological techniques, detecting viral antigens or antibodies, are widely used in diagnostic and epidemiological research, aiding in epidemic identification, appropriate diagnostic tests, vaccination programs, and detecting common and emerging viruses. However, traditional viral identification methods demand extensive technical expertise, time, and financial resources. Consequently, scientists worldwide are dedicated to developing precise diagnostic methods for viral diseases. Various innovative approaches are being explored, aiming to create more accessible, time-efficient, and cost-effective viral disease diagnosis methods, thereby benefiting low-income countries.

show abstract

“…The novel assay is based on the FRET principle (Förster resonance energy transfer; Förster, 1948) and uses the primer-probe energy transfer (PriProET) technology. This robust real-time PCR technology was previously successfully applied to detect a wide variety of viruses comprising vesicular disease viruses, hepatitis E virus, classical swine virus porcine reproductive and respiratory syndrome virus and porcine circovirus (Rasmussen et al, 2005;Hakhverdyan et al, 2006;Bálint et al, 2009). Compared to the most wide-spread real-time PCR system, the TaqMan method, PriProET is providing a higher flexibility in the detection of varying target nucleic acids.…”

Section: Introductionmentioning

confidence: 99%

Detection of subgenomic mRNA of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (P-sg-QPCR)

Hornyák

Bálint

Farsang

et al. 2012

Journal of Virological Methods

Self Cite

View full text Add to dashboard Cite

Feline infectious peritonitis is one of the most severe devastating diseases of the Felidae. Upon the appearance of clinical signs, a cure for the infected animal is impossible. Therefore rapid and proper diagnosis for both the presence of the causative agent, feline coronavirus (FCoV) and the manifestation of feline infectious peritonitis is of paramount importance. In the present work, a novel real-time RT-PCR method is described which is able to detect FCoV and to determine simultaneously the quantity of the viral RNA. The new assay combines the M gene subgenomic messenger RNA (sg-mRNA) detection and the quantitation of the genome copies of FCoV. In order to detect the broadest spectrum of potential FCoV variants and to achieve the most accurate results in the detection ability the new assay is applying the primer-probe energy transfer (PriProET) principle. This technology was chosen since PriProET is very robust to tolerate the nucleotide substitutions in the target area. Therefore, this technology provides a very broad-range system, which is able to detect simultaneously many variants of the virus(es) even if the target genomic regions show large scale of variations. The detection specificity of the new assay was proven by positive amplification from a set of nine different FCoV strains and negative from the tested non-coronaviral targets. Examination of faecal samples of healthy young cats, organ samples of perished animals, which suffered from feline infectious peritonitis, and cat leukocytes from uncertain clinical cases were also subjected to the assay. The sensitivity of the P-sg-QPCR method was high, since as few as 10 genome copies of FCoV were detected. The quantitative sg-mRNA detection method revealed more than 10-50,000 times increase of the M gene sg-mRNA in organ materials of feline infectious peritonitis cases, compared to those of the enteric FCoV variants present in the faeces of normal, healthy cats. These results indicate the applicability of the new P-sg-QPCR test as a powerful novel tool for the better detection and quantitation of FCoV and for the improved diagnosis of feline infectious peritonitis, this important disease of the Felidae, causing serious losses in the cat populations at a global scale.

show abstract

Development of Primer-Probe Energy Transfer real-time PCR for the detection and quantification of porcine circovirus type 2

Cited by 9 publications

References 27 publications

Innate immune responses induced by the saponin adjuvant Matrix-M in specific pathogen free pigs

Innate immune responses induced by the saponin adjuvant Matrix-M in specific pathogen free pigs

Trends of Diagnostic Methods for Human Viral Diseases

Detection of subgenomic mRNA of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (P-sg-QPCR)

Contact Info

Product

Resources

About