Contained and high‐level production of recombinant protein in plant chloroplasts using a temporary immersion bioreactor

Abstract

SummaryChloroplast transformation is a promising approach for the commercial production of recombinant proteins in plants. However, gene containment still remains an issue for the large-scale cultivation of transplastomic plants in the field. Here, we have evaluated the potential of using tobacco transplastomic cell suspensions for the fully contained production of a modified form of the green fluorescent protein (GFP+) and, a vaccine antigen, fragment C of tetanus toxin (TetC). Expression of these proteins in cell suspension cultures (and calli) was much less than in leaves, reaching 0.5%-1.5% of total soluble protein (TSP), but still produced 2.4-7.2 mg ⁄ L of liquid culture. Much better expression levels were achieved with a novel protein production platform in which transgenic cell suspension cultures were placed in a temporary immersion bioreactor in the presence of Thidiazuron to initiate shoot formation. GFP+ yield reached 660 mg ⁄ L of bioreactor (33% TSP), and TetC accumulated to about 95 mg ⁄ L (8% TSP). This new production platform, combining the rapid generation of transplastomic cell suspension cultures and the use of temporary immersion bioreactors, is a promising route for the fully contained low-cost production of recombinant proteins in chloroplasts.

Expression of the affinity tags, glutathione-S-transferase and maltose-binding protein, in tobacco chloroplasts

“…A plastome region containing the site of integration (rrn16 and rps12/7) was amplified by PCR from WT tobacco using primer RRN16-F (AATTCA CCGCCGTATGGCTGACCGGCGA) and RPS12/7-R (GA TCTTTCTCGATCAATCCCTTTGCCCCTCA), labelled with DIG High Prime DNA Labelling and Detection Starter Kit II (Roche Applied Science) and hybridised with digested genomic DNA from transplastomic plants. The specific signals were detected by exposing the membrane to X-ray film after incubating with anti-DIG (digoxigenin) antibodies and chloro-5-substituted adamantyl-1,2-dioxetane phosphate (CSPD) solution as described in Michoux et al (2011).…”

Plastid transformation for production of vaccines & therapeutic proteins

“…The domain IV of the protective antigen from Bacillus anthracis protective antigen domain IV was expressed in tobacco plants under the control of the Prrn promoter and TpsbA 3´-untranslated region in a dicistronic construct with aadA gene. ELISA tests TetC Clostridium tetani Tobacco cell culture 8 [14] FaeG Enterotoxigenic Escherichia coli Tobacco 1.5 [13] PA(dIV): Protective antigen domain IV.…”

“…In order to circumvent environmental issues due to gene containment with transplastomic plants, Michoux et al described an interesting new expression system, based on cell suspension cultures placed in a temporary immersion bioreactor [14]. Cell suspension cultures from the tobacco line producing the previously described TetC [15] were temporally immerged in a bioreactor in Murashige and Skoog media in the presence of thidiazuron, which induced shoot formation.…”

Pneumatic hydrodynamics influence transplastomic protein yields and biological responses during in vitro shoot regeneration of Nicotiana tabacum callus: Implications for bioprocess routes to plant-made biopharmaceuticals

“…Avoidance of permanent submergence facilitates adequate oxygen transfer, reduces physiological stress and encourages plant growth and differentiation [18]. TIBs have been used for experimental and commercial micropropagation for the high multiplication generation of high-quality shoots and plantlets of several species [18] and more recently for expression of recombinant proteins [16], [19], [20].…”

“…Petite Havana), through regeneration of shoots from callus tissue ( in vitro organogenesis), has been previously pursued by our group [16], [19], [20]. The study outlined in this publication is in continuity with these pioneering studies.…”