Expression of the affinity tags, glutathione-S-transferase and maltose-binding protein, in tobacco chloroplasts

Abstract

Chloroplast transformation offers an exciting platform for the safe, inexpensive and large-scale production of recombinant proteins in plants. An important advantage for the isolation of proteins produced in the chloroplast would be the use of affinity tags for rapid purification by affinity chromatography. To date, only His-tags have been used. In this study, we have tested the feasibility of expressing two additional affinity tags: glutathione-S-transferase (GST) and a His-tagged derivative of the maltose-binding protein (His₆-MBP). By using the chloroplast 16S rRNA promoter and 5' untranslated region of phage T7 gene 10, GST and His₆-MBP were expressed in homoplastomic tobacco plants at approximately 7% and 37% of total soluble protein, respectively. GST could be purified by one-step-affinity purification using a glutathione column. Much better recoveries were obtained for His₆-MBP by using a twin-affinity purification procedure involving first immobilised nickel followed by binding to amylose. Interestingly, expression of GST led to cytoplasmic male sterility. Overall, our work expands the tools available for purifying recombinant proteins from the chloroplast.

Investigating the Production of Foreign Membrane Proteins in Tobacco Chloroplasts: Expression of an Algal Plastid Terminal Oxidase

“…Seeds were grown in magenta boxes on Murashige and Skoog (MS) medium [38] supplemented with 8 g L −1 agar and 30 g L −1 sucrose. Plants were grown on soil in a greenhouse as described previously [39]. Transplastomic plants sensitive to highlight were grown in a growth room at 25°C, 16 h light/8 h dark, photosynthetic photon flux of 50 µmol photons m −2 s −1 provided by cool white fluorescent bulbs and 30% of humidity.…”

“…Transformation of the tobacco plastid genome and regeneration of transformed shoots was carried as described previously [39]. The primary shoots were analysed by PCR for the integration of transgenes into the tobacco plastome using a set of primers of which one primer, RPS-outside (TTCATGTTCCAATTGAACACTGTCCATT), sits on the plastid genome in a region outside the inserted sequences, and other primer was the corresponding forward primer, Cr-PTOX1-F-NdeI (GGCATACCATATGTATCCTTATGATGTTCCAGATTAT) used to amplify the gene for cloning.…”

“…Transplastomic plants were tested for homoplastomy as described previously [39]. Briefly, total genomic DNA, extracted from 4–6 week-old leaves, was digested with BglII, electrophoresed in a 1% (w/v) agarose gel and transferred to a nylon membrane by overnight capillary transfer.…”

Production of leafy biomass using temporary immersion bioreactors: an alternative platform to express proteins in transplastomic plants with drastic phenotypes

“…A concentration-dependent effect of protein accumulation on plant growth was also observed when glutathione- S -transferase (GST) was expressed in tobacco chloroplasts. High levels of GST expression caused aberrant pollen development thereby inducing cytoplasmic male sterility in the host plants (Ahmad et al 2012a), whereas lower levels of GST expression had no such effect (Le Martret et al 2011). …”

“…Similarly, the massive expression of phage lytic protein, PlyGBS, imposed a metabolic burden on the host plants (Oey et al 2009). Growth retardation was also observed when transplastomic expression of maltose-binding protein (MBP) reached 37 % of TSP, possibly due to impaired export of maltose from the chloroplast (Ahmad et al 2012a). Expression of a thylakoid membrane protein, the plastid/plastoquinol terminal oxidase (PTOX) from Chlamydomonas reinhardtii , within tobacco chloroplasts rendered plants sensitive to high light (Ahmad et al 2012b).…”