Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets

Abstract

Background: Over the past two decades, there has been a continued research on the role of small non-coding RNAs including microRNAs (miRNAs) in various diseases. Studies have shown that viruses modulate the host cellular machinery and hijack its metabolic and immune signaling pathways by miRNA mediated gene silencing. Given the immensity of coronavirus disease 19 (COVID-19) pandemic and the strong association of viral encoded miRNAs with their pathogenesis, it is important to study Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) miRNAs. Results: To address this unexplored area, we identified 8 putative novel miRNAs from SARS-CoV-2 genome and explored their possible human gene targets. A significant proportion of these targets populated key immune and metabolic pathways such as MAPK signaling pathway, maturity-onset diabetes of the young, Insulin signaling pathway, endocytosis, RNA transport, TGF-β signaling pathway, to name a few. The data from this work is backed up by recently reported high-throughput transcriptomics datasets obtains from SARS-CoV-2 infected samples. Analysis of these datasets reveal that a significant proportion of the target human genes were down-regulated upon SARS-CoV-2 infection. Conclusions: The current study brings to light probable host metabolic and immune pathways susceptible to viral miRNA mediated silencing in a SARS-CoV-2 infection, and discusses its effects on the host pathophysiology.

MicroRNA of N‐region from SARS‐CoV‐2: Potential sensing components for biosensor development

“…Distinct sequences were searched and extracted from the literature's computational prediction. 28 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 The gene profiling was done to all the extracted miRNA sequences for gene identifying purposes using the database in the GenBank ( https://www.ncbi.nlm.nih.gov/genbank/ ). miRNA nucleotide sequences of the SARS‐CoV‐2 N‐region were identified as 5′ AUCCAUGAGCAGUGCUGACUCAACUCAGGC 3′.…”

“…Distinct sequences were searched and extracted from the literature's computational prediction 28,33–40 . The gene profiling was done to all the extracted miRNA sequences for gene identifying purposes using the database in the GenBank (https://www.ncbi.nlm.nih.gov/genbank/).…”

miRNAs: The Key Regulator of COVID-19 Disease

“…However, virus can develop new mechanisms to escape host antiviral response and to ensure its propagation [90]. Many studies reported that both virus and host encode miRNAs [91][92][93][94][95], and there are many types of viral miRNA-host mRNA interactions [30,61]. Over the last two decades, hundreds of virus-encoded miRNAs have been identified [96].…”

Computational Prediction of RNA–RNA Interactions between Small RNA Tracks from Betacoronavirus Nonstructural Protein 3 and Neurotrophin Genes during Infection of an Epithelial Lung Cancer Cell Line: Potential Role of Novel Small Regulatory RNA

“…Beta-CoVs replicate into the cytoplasm, and most studies rely on the assumption that v-miRNAs derived from their genomes are processed by the host miRNA pathway [ 33 , 34 , 35 , 36 , 37 ]. Whether Beta-CoVs produce functional v-miRNAs has been controversial for several years [ 38 ].…”