Comparison of the gut microbiota of people in France and Saudi Arabia

Abstract

Background/Objectives:The gut microbiota contributes to energy acquisition from food, and changes in the gut microbiome are associated with obesity. The eating habits of Saudis are much different than those of Europeans, and our objective was to compare the fecal microbiota of obese and normal weight Saudis and French.Subjects/Methods:Illumina MiSeq deep sequencing was used to test the gut microbiota of 9 normal weight and 9 obese individuals from Saudi Arabia and 16 normal weight and 12 obese individuals from France.Results:Obese French possessed significantly more relative Proteobacteria (P=0.002) and Bacteroidetes (P=0.05) and had lower richness and biodiversity at all the operational taxonomic unit (OTU) cutoffs (P<0.05) than normal weight French. Obese Saudis possessed significantly more Firmicutes (P=0.001) without a difference in richness (P=0.2) and biodiversity (P=0.3) compared with normal weight Saudis. We found a common bacterial species core of 23 species existing in ⩾50% of obese and normal weight Saudis and 29 species in ⩾50% of obese and normal weight French. Actinomyces odontolyticus, Escherichia coli and Ruminococcus obeum were present in at least 50% of all individuals tested. French individuals had significantly higher richness and biodiversity compared with Saudis at all the OTU cutoffs (P<0.05).Conclusion:Microbiota differences between obese and normal weight French were not similar to those between obese and normal weight Saudis. The studies of different populations can result in contrasting data regarding the associations of the gut microbiota and obesity.

Short Chain Fatty Acids Prevent High-fat-diet-induced Obesity in Mice by Regulating G Protein-coupled Receptors and Gut Microbiota

“…To obtain high-quality sequences, the raw sequences were filtered and trimmed as previously reported646566. Then, sequences were clustered into operational taxonomic units (OTUs) with a distance limit of 0.03 (equivalent to 97% similarity) using the Usearch software (version 7.1 http://drive5.com/uparse/).…”

High relative abundance of firmicutes and increased TNF-α levels correlate with obesity in children

“…24,25 In the present study, we found a high relation of Firmicutes/Bacteroidetes in obese children which is consistent with other studies. 7,[26][27][28] These controversial results could be explained by lifestyles, ethnic groups, 29,30 geographic origin 23 and even by the different experimental, bioinformatics and cohort selection methodologies used. 31 Diet is considered a trigger of intestinal microbiota diversity by altering the gut microenvironment.…”

Food-grade cationic antimicrobial ε-polylysine transiently alters the gut microbial community and predicted metagenome function in CD-1 mice

“…The primer set was developed by Illumina (FwOvAd_341F 5'TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGCCTACGGGNGGCWGCAG) and (ReOvAd_785R 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTA CHVGGGTATCTAATCC). 69 PCRs were performed in a 96-well format on a Veriti thermal cycler (Life technology, Carlsbad, CA, USA) using 2x KAPA HiFi Hotstart ReadyMix (KAPA Biosystem, Wilmington, MA, USA). AMPure XP beads (Beckman Coulter, Danvers, MA, USA) were used to purify the V3/ V4 fragment amplicon from free primers and other contaminants.…”