Comparison of SARS-CoV-2 Evolution in Paediatric Primary Airway Epithelial Cell Cultures Compared with Vero-Derived Cell Lines

Abstract

SARS-CoV-2 can efficiently infect both children and adults, albeit with morbidity and mortality positively associated with increasing host age and presence of co-morbidities. SARS-CoV-2 continues to adapt to the human population, resulting in several variants of concern (VOC) with novel properties, such as Alpha and Delta. However, factors driving SARS-CoV-2 fitness and evolution in paediatric cohorts remain poorly explored. Here, we provide evidence that both viral and host factors co-operate to shape SARS-CoV-2 genotypic and phenotypic change in primary airway cell cultures derived from children. Through viral whole-genome sequencing, we explored changes in genetic diversity over time of two pre-VOC clinical isolates of SARS-CoV-2 during passage in paediatric well-differentiated primary nasal epithelial cell (WD-PNEC) cultures and in parallel, in unmodified Vero-derived cell lines. We identified a consistent, rich genetic diversity arising in vitro, variants of which could rapidly rise to near fixation within two passages. Within isolates, SARS-CoV-2 evolution was dependent on host cells, with paediatric WD-PNECs showing a reduced diversity compared to Vero (E6) cells. However, mutations were not shared between strains. Furthermore, comparison of both Vero-grown isolates on WD-PNECs disclosed marked growth attenuation mapping to the loss of the polybasic cleavage site (PBCS) in Spike, while the strain with mutations in Nsp12 (T293I), Spike (P812R) and a truncation of Orf7a remained viable in WD-PNECs. Altogether, our work demonstrates that pre-VOC SARS-CoV-2 efficiently infects paediatric respiratory epithelial cells, and its evolution is restrained compared to Vero (E6) cells, similar to the case of adult cells. We highlight the significant genetic plasticity of SARS-CoV-2 while uncovering an influential role for collaboration between viral and host cell factors in shaping viral evolution and ultimately fitness in human respiratory epithelium.

Evolutionary remodelling of N‐terminal domain loops fine‐tunes SARS‐CoV‐2 spike

“…The potential evolutionary drivers of NTD variation are further informed by our independent experiments with authentic SARS‐CoV‐2. Serial passage in Vero E6 cells selects for SARS‐CoV‐2 with a deletion of the polybasic cleavage site (ΔPBCS, Davidson et al , 2020 ; Bamford et al , 2022 ). In our studies in this background, further passage led to the emergence of a virus with spontaneous deletion of the entire N2 loop (Δ67–76, Fig 4E ).…”

“…This is supported by the emergence of NTD loop variants in other cell culture experiments (Shiliaev et al , 2021 ). Importantly, we have previously demonstrated that the passage of SARS‐CoV‐2 in Vero E6 cells, and the emergence of ΔPBCS viruses, results in attenuated replication in primary human airway cells (Bamford et al , 2022 ). Therefore, whilst the viruses characterised here possess altered replication in monkey‐derived Vero E6 cells, there is no reason to expect enhanced replication in humans.…”

“…Public Health England strain SARS‐CoV‐2 (strain name: England 02/20) (Holden et al , 2020 ) was isolated on VeroE6 cells and passaged three subsequent times on Vero E6 cells to passage four (P4). During passage, “PHE” lost the polybasic cleavage site in spike and whole genome sequencing and minor variant analysis further identified a population (~ 8%) harbouring an out‐of‐frame 27 nucleotide deletion (CTATACATGTCTCTGGGACCAATGGTA) resulting in a loss of 9 amino acids in the N2 loop AIHVSGTNG (Δ67–76) (Bamford et al , 2022 ). Clonal strains were isolated from the bulk population by limiting dilution on standard unmodified Vero cells in 96‐well plates; clones were subsequently expanded (additional two passages) and screened by RT‐PCR of full‐length spike followed by Sanger sequencing of generated amplicons (primer sequences available by request).…”

Flexible, disposable photocatalytic plastic films for the destruction of viruses

“…MDCK, cells for IAV, (ii) Vero cells for EMCV, and (iii) VAT cells, i.e. VeroE6 cells expressing human ACE2 and TMPRSS2, for SARS2 [ 35 , 36 ]. Dulbecco's modified Eagle's Medium (DMEM,) with 10% v /v Foetal calf serum (FCS) with penicillin and streptomycin (1% v / v ), was used for all routine cell and virus cultures, except FCS was omitted for work with PR8 and, replaced instead with 0.3 wt% bovine serum albumin (BSA) and TPCK (L-1-tosylamido-2-phenylethyl chloromethyl ketone)-treated trypsin (1 μg/mL), to facilitate multi-cycle infection.…”

“…This virus-containing solution was then used to assess the level of viral infectivity remaining on the sample. Virus infectivity was determined by TCID 50 measurements in 96 well plates (IAV and EMCV) [ 40 ], or by plaque assay in 24 well plates (SARS2) using a method described elsewhere [ 36 ], except modified using VAT cells and incubating infections for 48 h prior to determining the number of plaque forming units, PFU, produced. Calculated virus infectivity values were based on visual viral cytopathic effect measurements (WSN, EMCV and SARS2), or on red fluorescence measurements for PR8 using a Celigo cytometer.…”