Comparative studies of hemolymph physiology response and HIF-1 expression in different strains of Litopenaeus vannamei under acute hypoxia

Wei, Lin; Li, Yuhu; Qiu, Liguo; Zhou, Hailong; Han, Qian

doi:10.1016/j.chemosphere.2016.03.064

Cited by 22 publications

(11 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Decreased number of circulating cells in the hemolymph were detected after 48 h of air exposure. This same event was already detected in the shrimp Litopeneaus vannamei after 6 and 12 h of hypoxia (Wei et al, 2016), and in the mussel Mytilus coruscus (Sui et al, 2016). Lower hemocyte availability in the hemolymph can be a consequence of different outcomes caused by hypoxia, such as impaired proliferation, increased apoptosis/necrosis rate, as well as infiltration of hemocytes in other tissues (Mydlarz et al, 2006).…”

Section: Timesupporting

confidence: 61%

Hypoxia effects on oxidative stress and immunocompetence biomarkers in the mussel Perna perna (Mytilidae, Bivalvia)

Nogueira

Mello

Trevisan

et al. 2017

Marine Environmental Research

View full text Add to dashboard Cite

This study investigated the effects of hypoxia on oxidative stress response and immune function in mussels Perna perna exposed to air for 6, 12, 24 and 48 h. In air-exposed mussels, the antioxidant enzymes superoxide dismutase (SOD), catalase, and glutathione reductase (GR) activities were lower in gill tissues (24-48 h) and digestive gland (12 h), while the glutathione peroxidase and GR activities were increased in the digestive gland (48 h). In both tissues, aerial exposure promoted a rapid (6 h) and persistent (up to 48 h) increase of glutathione levels. Decreased hemocyte count and viability, as well as increased phagocytic activity and cellular adhesion capacity were detected after prolonged aerial exposure (>12 h). In summary, induction of thiol pools, altered antioxidant enzyme activities, and activation of immune responses were detected in hypoxia exposed brown mussels, indicating hypoxia induced tissue-specific responses in both antioxidant and immune systems.

show abstract

Section: Timesupporting

confidence: 61%

Hypoxia effects on oxidative stress and immunocompetence biomarkers in the mussel Perna perna (Mytilidae, Bivalvia)

Nogueira

Mello

Trevisan

et al. 2017

Marine Environmental Research

View full text Add to dashboard Cite

show abstract

“…As previous studies reported that exposure of invertebrate, including shrimp, to environmental (such as hypoxic condition) and pathogenic stresses can directly affect the concentration and function of hemocyanin, as well as the number of haemocytes within the haemolymph (Coates et al, ; Lorenzon et al, ; Mydlarz et al, ; Wei et al, ; Wen et al, ). We were interested in the effect of our designed herbal mixture on HC.…”

Section: Discussionmentioning

confidence: 97%

Effects of dietary supplementation of Astragalus membranaceus , Codonopsis pilosula , and Glycyrrhiza uralensis extract mixture on growth performance, haematological parameters and hepatopancreatic performance in juvenile Pacific white shrimp ( Litopenaeus vannamei )

et al. 2019

View full text Add to dashboard Cite

Pacific white shrimp is the major farmed shrimp species in the world. It is known to be very sensitive to the environmental and management changes such as intensification, which is one of the primary necessities to increase shrimp production, but represents a stressful condition, and needs to be managed properly to diminish its negative effects in aquaculture. In this study, juvenile Pacific white shrimp were fed diets supplementing with equal quantities of Astragalus membranaceus, Codonopsis pilosula and Glycyrrhiza uralensis extracts in different concentrations (0, 1.0, 2.0 and 3.0 g/kg) for 8 weeks. We subsequently estimated the effects of supplemented diets on growth performance, haematological parameters, and histological changes of hepatopancreas. Results revealed that the supplemented mixture had no benefits on growth and survival rate, but had favourable effects on haemocyte count, number of granulocytes, and hemocyanin concentration in the haemolymph (p > 0.05). We observed that R cells and B cells were increased in hepatopancreatic tubules of shrimps fed on supplemented diets. Besides, a diet containing 2.0 g/kg of extract mixture maintained the decreased levels of alanine aminotransferase (p < 0.05) and aspartate aminotransferase (p > 0.05). Among the used concentrations, 2.0 g/kg seemed to be the most suitable concentration. K E Y W O R D S Astragalus membranaceus, Codonopsis pilosula, Glycyrrhiza uralensis, histology, immune response, Litopenaeus vannamei How to cite this article: Prathomya P, Hussein HA, Tran NT, et al. Effects of dietary supplementation of Astragalus membranaceus, Codonopsis pilosula, and Glycyrrhiza uralensis extract mixture on growth performance, haematological parameters and hepatopancreatic performance in juvenile Pacific white shrimp (Litopenaeus vannamei). Aquac Res.

show abstract

“…The extraction of total RNA and reverse transcription, as well as the qRT-PCR, were performed per the methods of our previously paper (Wei et al, 2016 ). GDH -β, GS and TG were determined for each cDNA using qRT-PCR on a ROCHE Light Cycler 96 Real-Time Cycler PCR Detection System (Roche Applied Science, Mannheim, Germany) using the following specific primers, Forward/Reverse sequence for GDH -β (5'−3') (CTTTCCAGGATCGCATTTCT; AAGCAG CAGTACGGAGATCAA) and GS (GGCATGGAGCAGGAGTA; CGCCGCAGT AGTAGGGT); for TG (CCTCAGGATCTCCTTCACCA; TTGGGAAAACCTTCA TTTCG); as well as the β-actin (CGCGACCTCACAGACTACCT, GTGGTCATC TCCTGCTCGAA) (Li and Wormhoudt, 2015 ; Liu et al, 2016 ).…”

Section: Methodsmentioning

confidence: 99%

“…Compared with native shrimp, the progeny of the imported parent prawns adapts poorly to local conditions, resulting in suboptimal farming conditions (Briggs et al, 2004 ). In recent years, studies have mainly focused on the effects of temperature stress (Zhou et al, 2011 ), osmotic stress (Liu et al, 2012 ), viral infections (Song et al, 2003 ), salinity (Silvia et al, 2004 ), and acute hypoxia (Wei et al, 2016 ). However, few studies have investigated ammonia-metabolizing enzymes in different tissues of local strains of L. vannamei in response to ammonia stress.…”

Section: Introductionmentioning

confidence: 99%

Changes of Ammonia-Metabolizing Enzyme Activity and Gene Expression of Two Strains in Shrimp Litopenaeus vannamei Under Ammonia Stress

Qiu

Shi

et al. 2018

Front. Physiol.

Self Cite

View full text Add to dashboard Cite

Ammonia stress can inhibit the survival and growth, and even cause mortality of shrimp. In this study, ammonia-metabolizing enzyme activities and gene expression were compared between two strains of L. vannamei under different ammonia-N (NH4+) concentrations (3.4, 13.8, and 24.6 mg/L). The results showed that elevated ammonia concentrations mainly increased glutamine synthetase (GSase) activities while inhibiting transglutaminase (TGase) activities in the muscle of both strains. Thus, we concluded that L. vannamei could accelerate the synthesis of glutamine from glutamate and NH4+ to alleviate ammonia stress. Compared with the muscle, the hepatopancreas plays a major role in ammonia stress and might be a target tissue to respond to the ammonia stress. Compared to the control group, the treatment of high ammonia concentrations reduced the hepatopancreas TGase (TG) gene expression and increased the gene expression rates of glutamate dehydrogenase-β (GDH-β) and GSase (GS) in both the muscle and the hepatopancreas of the two strains (p < 0.05). These genes (GDH-β and GS) in strain B were not only expressed earlier but also at levels higher than the expression range of strain A. At the gene level, strain B showed a more rapid and positive response than strain A. These data might help reveal the physiological responses mechanisms of shrimp adapt to ammonia stress and speed up the selective breeding process in L. vannamei.

show abstract

Comparative studies of hemolymph physiology response and HIF-1 expression in different strains of Litopenaeus vannamei under acute hypoxia

Cited by 22 publications

References 62 publications

Hypoxia effects on oxidative stress and immunocompetence biomarkers in the mussel Perna perna (Mytilidae, Bivalvia)

Hypoxia effects on oxidative stress and immunocompetence biomarkers in the mussel Perna perna (Mytilidae, Bivalvia)

Effects of dietary supplementation of Astragalus membranaceus , Codonopsis pilosula , and Glycyrrhiza uralensis extract mixture on growth performance, haematological parameters and hepatopancreatic performance in juvenile Pacific white shrimp ( Litopenaeus vannamei )

Changes of Ammonia-Metabolizing Enzyme Activity and Gene Expression of Two Strains in Shrimp Litopenaeus vannamei Under Ammonia Stress

Contact Info

Product

Resources

About