Cloning and expression of the human transient receptor potential 4 (TRP4) gene: localization and functional expression of human TRP4 and TRP3

McKay, Richard R.; Szymeczek-Seay, Caroline L.; Lièvremont, Jean-Philippe; Bird, Gary S.; Zitt, Christof; Jüngling, Eberhard; Lückhoff, Andreas; Putney, James W.

doi:10.1042/bj3510735

Cited by 97 publications

(32 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The reported electrophysiological properties of TRPC4 vary significantly; e.g., from a store-operated, nonselective cation current in CHO cells [17] to a Ca 2+ -selective I CRAC channel in adrenal cells [13,24]. Moreover, TRPC4 channels expressed alone are doubly rectifying, but are outwardly rectifying when coexpressed with TRPC1 (reviewed in [27]).…”

Section: Discussionmentioning

confidence: 97%

“…TRPC4-specific PCR primers were designed from the human TRPC4 cDNA sequence (Genbank accession number AF175406; [17]) using the Primer 3 program (http://frodo.wi.mit.edu/primer3/ primer3.FAQ.html). The TRPC4 primers used were 5′ ACTAAAATTGGCCATTAAGTACCGTCA 3′ (nucleotides 1,095-1,121; forward) and 5′ CGGTAATATCATC CACTCGACGA 3′ (nucleotides 1,455-1,479; reverse).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Evidence that TRPC4 supports the calcium selective ICRAC-like current in human gingival keratinocytes

Fatherazi

Presland

Belton

et al. 2006

Pflugers Arch - Eur J Physiol

View full text Add to dashboard Cite

We previously demonstrated that high external [Ca(2+)] activated two Ca(2+) currents in human gingival keratinocytes (HGKs): an initial small I(CRAC)-like current and a second large nonspecific cation current (Fatherazi S, Belton CM, Cai S, Zarif S, Goodwin PC, Lamont RJ, Izutsu KT; Pflugers Arch 448:93-104, 2004). It was recently shown that TRPC1, a member of the transient receptor potential protein family, is a component of the store-operated calcium entry mechanism in keratinocytes. To further elucidate the molecular identity of these channels, we investigated the expression of TRPC4 in gingival tissue and in cultured keratinocytes, and the effect of knockdown of TRPC4 expression on the Ca(2+) currents and influx. Immunohistochemistry showed TRPC4 was present in gingival epithelium as well as in HGKs cultured in different [Ca(2+)]s. Results from tissue and cultured HGKs demonstrated TRPC4 expression decreased with differentiation. Knockdown of TRPC4 in proliferating HGKs with antisense oligonucleotides significantly reduced the intracellular [Ca(2+)] increase obtained upon exposure to high external [Ca(2+)]. Antisense knockdown of TRPC4 expression was confirmed by reverse transcriptase polymerase chain reaction, Western blot, and immunofluorescence microscopy of transfected HGKs. Immunofluorescence microscopy and patch clamp measurements in Lucifer-yellow-tagged, antisense-treated HGKs showed attenuation of TRPC4 expression levels as well as attenuation of the I(CRAC)-like current in the same cell, whereas the large nonspecific cation current was unchanged but significantly delayed. Cells transfected with a scrambled TRPC4 oligonucleotide showed no change in either the I(CRAC)-like or nonspecific currents. The results indicate that TRPC4 is an important component of the I(CRAC)-like channel in HGKs.

show abstract

Section: Discussionmentioning

confidence: 97%

Section: Methodsmentioning

confidence: 99%

Evidence that TRPC4 supports the calcium selective ICRAC-like current in human gingival keratinocytes

Fatherazi

Presland

Belton

et al. 2006

Pflugers Arch - Eur J Physiol

View full text Add to dashboard Cite

show abstract

“…The quality of total RNA was checked using an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Palo Alto, CA). The TRPC1 primer pair was that of McKay et al [21], and the involucrin mRNA primer pair used was that of LaCelle et al [17]. The β-actin mRNA primer pair was from Invitrogen.…”

Section: Methodsmentioning

confidence: 99%

Evidence that TRPC1 contributes to calcium-induced differentiation of human keratinocytes

Cai

Fatherazi

Presland

et al. 2005

Pflugers Arch - Eur J Physiol

View full text Add to dashboard Cite

External calcium ion concentration is a major regulator of epidermal keratinocyte differentiation in vitro and probably also in vivo. Regulation of calcium-induced differentiation changes is proposed to occur via an external calcium-sensing, signaling pathway that utilizes increases in intracellular calcium ion concentration to activate differentiation-related gene expression. Calcium ion release from intracellular stores and calcium ion influx via store-operated calcium-permeable channels are key elements in this proposed signaling pathway; however, the channels involved have not yet been identified. The present report shows that human gingival keratinocytes (HGKs) also undergo calcium-induced differentiation in vitro as indicated by involucrin expression and morphological changes. Moreover, TRPC1, which functions as a store-operated calcium channel in a number of cell types, including epidermal keratinocytes, is expressed in both proliferating and differentiating HGKs. Transfection of HGKs with TRPC1 siRNA disrupted expression of TRPC1 mRNA and protein compared with transfection with scrambled TRPC1 siRNA. Cells with disrupted TRPC1 expression showed decreased calcium-induced differentiation as measured by involucrin expression or morphological changes, as well as decreased thapsigargin-induced calcium ion influx, and a decreased rate of store calcium release. These results indicate that TRPC1 is involved in calcium-induced differentiation of HGKs likely by supporting a store-operated calcium ion influx.

show abstract

“…(47). With regard to heterologously expressed TRPC4 and TRPC5, it should be noted that some studies reported an inhibition by micromolar lanthanide concentrations (14,48).…”

Section: Discussionmentioning

confidence: 99%

Lanthanides Potentiate TRPC5 Currents by an Action at Extracellular Sites Close to the Pore Mouth

Jung¹,

Mühle

Schaefer

et al. 2003

Journal of Biological Chemistry

234

227

View full text Add to dashboard Cite

Mammalian members of the classical transient receptor potential channel (TRPC) subfamily (TRPC1-7and Gd 3؉ have opposite effects on whole cell currents through TRPC5 and TRPC6 channels. The potentiation of TRPC4 and TRPC5 by micromolar La 3؉ at extracellular sites close to the pore mouth is a promising tool for identifying the involvement of these isoforms in receptor-operated cation conductances of native cells. Mammalian isoforms of the classical transient receptor potential channel (TRPC)1 subfamily, TRPC1-7, are likely candidates for cation channels mediating phospholipase C-dependent, receptor-operated Ca 2ϩ influx (for reviews, see Refs. 1-5). The properties and activation mechanisms of TRPCs have been studied extensively in heterologous expression systems. By contrast, relatively little information is available on their role in native cells. Two recent studies (6, 7) report that endogenous receptor-stimulated cation currents in vascular smooth muscle cells show properties identical to those described for heterologously expressed TRPC6. Therefore, precise knowledge of the properties of heterologously expressed TRPC channels may be essential to evaluate the involvement of TRPC proteins in receptor-operated cation conductances in native cells.Structurally, TRP channels, like many other cation channels, have been proposed to have six transmembrane segments (S1-S6), intracellular N and C termini, and a pore-forming reentrant loop between S5 and S6. Based on amino acid sequence similarity, the mammalian members of the TRPC subfamily can be subdivided into four groups (4, 8): TRPC1 (group 1), TRPC2 (group 2), TRPC3/6/7 (group 3), and TRPC4/5 (group 4). This subdivision is also supported by functional data. One of the major functional criteria is the mechanism of channel activation. From studies in heterologous expression systems, it is undisputed that receptor-mediated stimulation of phospholipase C is a key event in the activation of all TRPC isoforms. Evidence indicates that currents mediated by TRPC3, TRPC6, or TRPC7 can be activated by diacylglycerol (DAG) independently of protein kinase C (9 -12), although there is some controversy regarding the physiological significance of this stimulation (13). By contrast, TRPC4 and TRPC5 are not activated by DAG, and some evidence indicates that unidentified components of the phospholipase C pathway other than DAG or store depletion activate the channels (14 -16). Other evidence supports a store-dependent activation mechanism (17)(18)(19)(20). TRPC1 has been reported to be a store-dependent channel in some studies (21-23), but doubts have been raised as to whether TRPC1 expression results in the formation of functional plasma membrane channels in mammalian cells (16,24,25). The few data available support a store-operated activation mechanism for TRPC2 (26, 27), but, here again, other evidence suggests that TRPC2 does not form functional channels in all tissues (28). Data from our group, confirmed in several independent laboratories, indicate that several biophysical fe...

show abstract

Cloning and expression of the human transient receptor potential 4 (TRP4) gene: localization and functional expression of human TRP4 and TRP3

Cited by 97 publications

References 52 publications

Evidence that TRPC4 supports the calcium selective ICRAC-like current in human gingival keratinocytes

Evidence that TRPC4 supports the calcium selective ICRAC-like current in human gingival keratinocytes

Evidence that TRPC1 contributes to calcium-induced differentiation of human keratinocytes

Lanthanides Potentiate TRPC5 Currents by an Action at Extracellular Sites Close to the Pore Mouth

Contact Info

Product

Resources

About