Clinical Application of the Polymerase Chain Reaction for a Rapid Diagnosis of Mycobacterium tuberculosis Infection.

Abstract

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3\ The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conven tional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

Detection of Toxoplasma gondii, Epstein-Barr Virus, and JC Virus DNAs in the Cerebrospinal Fluid in Acquired Immunodeficiency Syndrome Patients with Focal Central Nervous System Comlications.

“…The polymerase chain reaction (PCR) is well recognized as a sensitive, specific, and rapid diagnostic technique for the diagnosis of a variety of infections. Wehave applied this method previously for the diagnosis of Pneumocystis carinii pneumonia (7) and Mycobacterium tuberculosis infections (8). Partial or whole DNAsequences of Toxoplasma gondii (T. gendii), Epstein-Barr virus (EBV) and JC virus (JCV), representing the pathogenic microbes for TE, PCNSLand PML, respectively, are already known (9,10).…”

Role of Borrelia burgdorferi in the pathogenesis of morphea/scleroderma and lichen sclerosus et atrophicus: a PCR study of thirty‐five cases

“…Recently, the polymerase chain reaction (PCR) has been used to detect microorganisms such as mycobacteria in skin biopsies (6,7). Serological identification of Bb, which until recently was the preferred method to detect Bb infection, is timeconsuming and cumbersome with low sensitivity (8)(9)(10).…”

Detection of Pneumocystis carinii, Mycobacterium tuberculosis, and Cytomegalovirus in Human Immunodeficiency Virus (HIV)-infected Patients with Hemophilia by Polymerase Chain Reaction of Induced Sputum Samples.

“…These results suggest that the sputuminduction methodis safe to use in HIV-infected hemophilia patients. HIV-infected patients with PCP, pulmonary tuberculosis, and CMVpneumonitis without any abnormalities on chest X- (5)(6)(7). We attempted to diagnose the initial stage of acute pulmonary infections due to P. carinii, M. tuberculosis, and CMVat the highly sensitive and specific level by PCR combined with the induced sputum method.…”