Both malvaceous and non-malvaceous betasatellites are associated with two wild cotton species grown under field conditions in Pakistan

Abstract

Betasatellites are symptom-modulating DNA satellites that are associated with the majority of monopartite begomoviruses in the Old World. Betasatellites show both geographical and host-specific relatedness; those isolated from malvaceous hosts form one group and those isolated from non-malvaceous hosts form the second group. Real-time PCR based estimation of begomovirus DNA in cotton species grown in a living herbarium under field conditions at the Central Cotton Research Institute (CCRI), Multan was carried out to understand their role in the ongoing cotton leaf curl disease (CLCuD) epidemic in Pakistan. The levels of begomovirus DNA in cotton species from the herbarium was found to be several folds lower than symptomatic plants of commercially grown cotton. Among herbarium species Gossypium anomalum, G. robinsoni and G. somalense contained higher levels of begomovirus DNA in comparison to other wild species. Characterization of betasatellites from two cotton species (G. anomalum and G. somalense) was carried out to understand their role in accumulation of begomovirus DNA. Here, we show that the two wild species of cotton are associated with Cotton leaf Multan betasatellite (CLCuMB), a malvaceous betasatellite associated with CLCuD, as well as Chili leaf curl betasatellite, a non-malvaceous betasatellite not previously identified in a malvaceous host. This is the first evidence of the presence of a non-malvaceous betasatellite in malvaceous hosts.

The Merging of Two Dynasties—Identification of an African Cotton Leaf Curl Disease-Associated Begomovirus with Cotton in Pakistan

“…A phylogenetic analysis of NGVB, based upon an alignment with all ChLCB sequences available in the databases (23 available at this time), is shown in Figure 3. This shows NGVB to segregate with ChLCB isolates recently isolated from cotton in Pakistan [22] and a single ChLCB isolated from chilli pepper ( Capsicum spp. ; AJ316032; [23]).…”

RNA interference-based resistance against a legume mastrevirus

“…Quantitative PCR (qPCR) was performed for the quantification of viral DNA in transgenic plants (showing resistance against CpCDPKV) and non-transgenic plants (showing infection for CpCDPKV) by using SYBER green dye (IQ SYBER Green supermix, BIO-RAD USA) as described previously [41]. Based on the nucleotide sequence of CpCDPKV (AM849097), a primer pair QF (5'TAAAAGGCGCACTAATGGGTAGACCGTAGA3' - spanning nucleotide coordinates 102-131) and QR (5'GGCGATAACCACCTTCCCG3' - spanning nucleotide coordinates 251-233) was designed to amplify a product of 150 bp specific to CpCDPKV.…”

Biochemical alterations in leaves of resistant and susceptible cotton genotypes infected systemically by cotton leaf curl Burewala virus

“…Its causative agent has been characterized from Pakistan, India, and Sudan (Azhar et al 2010) and disease was found to be caused by a complex of monpartite begomoviruses and a small symptom modulating, single stranded satellite DNA β component transmitted by the whitefly Bemisia tabaci (Akhtar et al 2013). The begomovirus-betasatellite complexes that cause leaf curl disease in cotton in Asia and Africa are distinct.…”