Biomarkers in Infectious Diseases

Hwang, Hyundoo; Hwang, Boo-Young; Bueno, Juan

doi:10.1155/2018/8509127

Cited by 34 publications

(21 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Those types of diseases have been major issues worldwide affecting public health and economy of many countries. Investigation on the ideal biomarkers for diagnostics of infectious diseases (with high sensitivity, specificity, and predictive capacity) in the beginning must be focused on detection and identification of the virulence agents (Hwang et al, 2018;Mohan & Harikrishna, 2015). Serious infection outbreaks often present from fish and other foods creating a diagnostic challenge for clinicians.…”

Section: Resultsmentioning

confidence: 99%

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Ethica

Darmawati²,

Dewi³

et al. 2020

Squalen Bull. Marine Fisheries Postharvest Biotech.

View full text Add to dashboard Cite

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

show abstract

Section: Resultsmentioning

confidence: 99%

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Ethica

Darmawati²,

Dewi³

et al. 2020

Squalen Bull. Marine Fisheries Postharvest Biotech.

View full text Add to dashboard Cite

show abstract

“…Infections are one of the most daunting threats to humanity, responsible for an immense burden of disabilities and deaths 1 . Pandemics of influenza (Spanish flu, swine flu, bird flu), recent outbreaks of Ebola and Zika virus, deadly and wide-spread epidemics of MERS and SARS, as well as the found located next to CRISPR repeat-spacer arrays 18 .…”

Section: Introductionmentioning

confidence: 99%

CRISPR-Cas Systems for Diagnosing Infectious Diseases

Kostyusheva¹,

Brezgin²,

Babin³

et al. 2020

Preprint

View full text Add to dashboard Cite

Infectious diseases are a global health problem affecting billions of people. Developing rapid and sensitive diagnostic tools is key for successful patient management and curbing disease spread. Currently available diagnostics are very specific and sensitive but time-consuming and require expensive laboratory settings and well-trained personnel; thus, they are not available in resource-limited areas, for the purposes of large-scale screenings and in case of outbreaks and epidemics. Developing new, rapid, and affordable point-of-care diagnostic assays is urgently needed. This review focuses on CRISPR-based technologies and their perspectives to become platforms for point-of-care nucleic acid detection methods and as deployable diagnostic platforms that could help to identify and curb outbreaks and emerging epidemics. We describe the mechanisms and function of different classes and types of CRISPR-Cas systems, including pros and cons for developing molecular diagnostic tests and applications of each type to detect a wide range of infectious agents. Many Cas proteins (Cas9, Cas12, Cas13, Cas14) have been leveraged to create highly accurate and sensitive diagnostic tools combined with technologies of signal amplification and fluorescent, potentiometric, colorimetric, or lateral flow assay detection. In particular, the most advanced platforms -- SHERLOCK/v2, DETECTR, or CRISPR-Chip -- enable detection of attomolar amounts of pathogenic nucleic acids with specificity comparable to that of PCR but with minimal technical settings. Further developing CRISPR-based diagnostic tools promises to dramatically transform molecular diagnostics, making them easily affordable and accessible virtually anywhere in the world. The burden of socially significant diseases, frequent outbreaks, recent epidemics (MERS, SARS and the ongoing coronoviral nCov-2019 infection) urgently need the developing of express-diagnostic tools. Recently devised CRISPR-technologies represent the unprecedented opportunity to reshape epidemiological surveillance and molecular diagnostics.

show abstract

“…Emerging and re-emerging infectious diseases are one of the most intimidating threats to human race, responsible for an immense burden of disabilities and deaths. [1] Pandemics of Spanish flu, [2] swine flu, [3] bird flu, [4] Zika [5] and Ebola virus, [6] deadly and wide-spread epidemics of SARS and MERS, [7] as well as the ongoing outbreak of COVID-19 epidemic, originated in China in 2019, stroke countries and emerge as the most recent examples of widespread infections reported in this century. [8] Unfortunately, most researches focus on finding cures and vaccines for these diseases instead of give diagnostic field its well contribution of these researches to help to diagnose it in rapid and precise approach to accelerate the quarantine; in the recant years Discovery of the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated protein (Cas) (CRISPR-Cas) revolutionized biology and is already pushing health care systems to the era of precise molecular medicine.…”

Section: Introductionmentioning

confidence: 99%

<strong>SHERLOCK and DETECTR: CRISPR-Cas Systems as Potential Rapid Diagnostic Tools for Emerging Infectious Diseases and Cancer-Associated Mutations</strong>

Mustafa¹,

Makhawi²

2020

Preprint

View full text Add to dashboard Cite

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

show abstract

Biomarkers in Infectious Diseases

Cited by 34 publications

References 3 publications

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

CRISPR-Cas Systems for Diagnosing Infectious Diseases

<strong>SHERLOCK and DETECTR: CRISPR-Cas Systems as Potential Rapid Diagnostic Tools for Emerging Infectious Diseases and Cancer-Associated Mutations</strong>

Contact Info

Product

Resources

About