2011
DOI: 10.1590/s0102-86502011000800019
| View full text |Cite
|
Sign up to set email alerts
|

Abstract: PURPOSE:To present fundamental anatomical aspects and technical skills necessary to urethra and urinary bladder catheterization in female mice and rats. METHODS: Urethral and bladder catheterization has been widely utilized for carcinogenesis and cancer research and still remains very useful in several applications: from toxicological purposes as well as inflammatory and infectious conditions to functional aspects as bladder dynamics and vesicoureteral reflux, among many others. RESULTS: Animal models are in t… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1

Citation Types

0
24
0
2

Year Published

2014
2014
2023
2023

Publication Types

Select...
6
1
1
1

Relationship

0
9

Authors

Journals

citations
Cited by 33 publications
(26 citation statements)
references
References 6 publications
0
24
0
2
Order By: Relevance
“…For mouse urinary tract infection analyzes were used 6-8 weeks-old female BALB/c mice (CEMIB, UNICAMP, Brazil). Infections were carried out by transurethral inoculation as previously described (46,47). UKP8 and kpfR::kan R strains were grown on LB agar plates at 37°C for 18 h and resuspended at a concentration of 5 x 495-496 CATCATATTGCTAAGGTCGGTGGCCTGA GC-intron-AATTTTCTTATTATT 9.52 0,034…”
Section: Discussionmentioning
confidence: 99%
“…For mouse urinary tract infection analyzes were used 6-8 weeks-old female BALB/c mice (CEMIB, UNICAMP, Brazil). Infections were carried out by transurethral inoculation as previously described (46,47). UKP8 and kpfR::kan R strains were grown on LB agar plates at 37°C for 18 h and resuspended at a concentration of 5 x 495-496 CATCATATTGCTAAGGTCGGTGGCCTGA GC-intron-AATTTTCTTATTATT 9.52 0,034…”
Section: Discussionmentioning
confidence: 99%
“…Five mice were employed in each group viz., P. mirabilis (Pet+), EAEC 042 (Pet+), P. mirabilis (Pet-) and a control group remained uninfected (inoculated only with PBS). Mice were anesthetized with ketamine [60mg/Kg] and xilazine [10mg/Kg], and transurethral inoculated with 50 μL of the corresponding bacterial suspension containing approximately 5X10 7 CFU (Reis et al, 2011;Hung, Dodson & Hultgren, 2009).…”
Section: Urinary Tract Infectionmentioning
confidence: 99%
“…Most UTUCs are found to be invasive at diagnosis, whereas most bladder urothelial cancers are non‐muscle invasive. Though it corresponds to approximately 10% of all human urothelial cancers, extrapolating data from the other 90% (mainly bladder cancer) might deter the advancement of UTUC knowledge and management …”
Section: Advantages and Disadvantages Of Diverse Animal Modelsmentioning
confidence: 99%
“…Although they are strong tools, there is no perfect animal model. The restriction to female animals to allow intravesical drug delivery, limiting off‐target effects in an extraordinary example of direct therapeutics administration against solid tumor, it impedes the male microenvironment because of the challenges related to the common duct for reproduction and urinary functions in males …”
Section: Advantages and Disadvantages Of Diverse Animal Modelsmentioning
confidence: 99%