Analysis of Neisseria meningitidis class 3 outer membrane protein gene variable regions and type identification using genetic techniques

Abstract

The class 3 porin proteins of Neisseria meningitidis stimulate bactericidal antibodies and express serotypespecific antigenic epitopes. Sequence analysis of porB genes for the class 3 proteins revealed regions of variability that map to surface-exposed loops. To evaluate the relationship between serotype and variableregion (VR) genotype, sequences from the 11 class 3-expressing serotype strains and 3 additional serotype 4 strains were analyzed by molecular techniques. Multiple-sequence alignment revealed a limited number of unique sequences at each of four VRs (VR1 to VR4), ranging from four unique sequences at VR1 to seven sequence patterns at VR2 and VR4. Serotype-specific VR sequences were found in each of the four VRs, suggesting that each VR has immunologic importance. Five serotypes had at least one VR sequence that was unique. Three serotypes which had sequences in common with other serotypes at each VR were distinguished by examining multiple VRs. Serotype 3 was identical to serotype 19 at each VR, and serotype 8 was identical to serotype 18 at each VR. Serotypes 4 and 21 were identical at VR1 and significantly different at VR3 and VR4. A subpopulation of serotype 4 strains with a unique VR2 sequence was identified. The serotypes which were grouped with closely related or identical sequences at one VR were grouped with different serotypes at other VRs consistent with the pattern of genetic mosaicism described for the porA (class 1 protein) gene. Hybridization assays demonstrated the ability to identify VR genotypes and distinguish serotypes using biotin-labelled oligonucleotide probes. This information may be useful in strain selection for vaccine development, in epidemiologic studies to determine the prevalence of the individual VR genotype (especially among nonserotypeable strains) and, combined with PCR, in the identification of culture-negative suspected meningococcal cases. Neisseria meningitidis causes both endemic and epidemic meningitis and septicemia worldwide. Epidemic group A meningococcal disease occurs at rates of 100 to 500 cases per 100,000 people per year. Rates of endemic disease, primarily caused by groups B and C, range from 1 to 3 cases per 100,000 people and increase to 10 to 50 cases per 100,000 people per year during outbreaks. A serotype 15 group B clone has been responsible for outbreaks in northern Europe, and a serotype 4 clone has been responsible for epidemic group B disease in Brazil and Cuba (18). Currently, capsular polysaccharide vaccines are available only for serogroups A, C, Y, and W-135. The group B capsular polysaccharide is poorly immunogenic and is chemically identical to the carbohydrate moiety of the fetal neural cell adhesion molecule (5), so the feasibility of a group B-specific conjugate vaccine has been questioned (5, 27). Also, the polysaccharide vaccines currently available are not useful in very young children, who constitute the population with the highest attack rates. The meningococcal outer membrane proteins (OMPs) are currently under investigation as a...

Genetic and immunologic characterization of a novel serotype 4, 15 strain of Neisseria meningitidis

“…Molecular typing of strains Ch501, Cu385 and H355 using hybridization of biotinylated oligonucleotide probes was performed as previously described [18]. Probes and hybridization temperatures (T H ) used in this study were : VR1^4 (gagcacaatggaggtcaggtggttagcgtt), 54³C ; VR1^15 (tttcaccagaacggccaagttactgaagtt), 52³C; VR2^4a (gtgcgggtggatgagaacgtg), 54³C ; VR2^21 (caggatgtggatgacgtgaag), 42³C ; VR2^15 (catcaagtgcaagagggcttg), 42³C; VR3^4 (caaattggttgaagacaatta), 44³C; VR3^15 (aaactgactgatgcttccaat), 42³C; VR4^4 (aaaggctcgtttgatgatgcagacttaagc), 52³C ; VR4^15 (aaaggtttggttgataatgcagacataggc), 52³C.…”

“…Polymerase chain reaction (PCR) ampli¢cation of the class 3 gene from group B meningococcal strain Ch501 was performed as previously described [18]. PCR products were puri¢ed using gel permeation columns, digested with XbaI and HindIII restriction endonucleases, isolated from LMP agarose, ligated into pT7^5 vectors, and transformed into Escherichia coli DH5K.…”

“…A model of these proteins predicts eight surface exposed loops with remarkable similarity between the di¡erent porins in the trans-membrane regions [16,17]. Four regions of variability between serotypes in the genes coding for meningococcal PorB class 3 proteins have been mapped to surface exposed loops 1, 5, 6 and 7 [18,19], and it is predicted that these loops form the epitopes for both serotyping and bactericidal antibodies. Biotinylated oligonucleotide probes have been used in hybridization assays to identify porB variable region (VR) genotypes [18].…”

“…Four regions of variability between serotypes in the genes coding for meningococcal PorB class 3 proteins have been mapped to surface exposed loops 1, 5, 6 and 7 [18,19], and it is predicted that these loops form the epitopes for both serotyping and bactericidal antibodies. Biotinylated oligonucleotide probes have been used in hybridization assays to identify porB variable region (VR) genotypes [18]. Serotype 4 and serotype 15 strains of N. meningitidis are epidemiologically, serologically, and genetically di¡erent [14,18,20].…”

“…Biotinylated oligonucleotide probes have been used in hybridization assays to identify porB variable region (VR) genotypes [18]. Serotype 4 and serotype 15 strains of N. meningitidis are epidemiologically, serologically, and genetically di¡erent [14,18,20]. Studies were undertaken to characterize a disease isolate from Chile, Ch501, which unexpectedly reacted with both type 4 and type 15 serotyping monoclonal antibodies.…”