A study of the interactions that stabilize DNA frayed wires

Abu-Ghazalah, Rashid M.; Irizar, J.; Helmy, Amr S.; Macgregor, Robert B.

doi:10.1016/j.bpc.2010.01.003

Cited by 18 publications

(18 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Raman spectroscopy (RS) has proved to be a useful technique for the investigation of G4 structures . Thomas and co‐workers performed extensive Raman and UV‐resonance Raman (UVRR) spectroscopic studies of the Oxytricha nova telomeric (OxyTel) sequence, which forms a parallel tetramolecular G4 in K + solution and an antiparallel bimolecular G4 in Na + solution (depending on the number of sequential G‐tracts) .…”

Section: Introductionmentioning

confidence: 99%

“…[19,27,28] Raman spectroscopy (RS) has proved to be a useful technique for the investigation of G4 structures. [1,[29][30][31][32][33][34][35][36][37][38][39][40] Thomas and co-workers performed extensive Raman and UV-resonance Raman (UVRR) spectroscopic studies of the Oxytricha nova telomeric (OxyTel) sequence, which forms a parallel tetramolecular G4 in K + solution and an antiparallel bimolecular G4 in Na + solution (depending on the number of sequential G-tracts). [1,[30][31][32][33]35] In this seminal body of work, the distinct Raman signatures of parallel and antiparallel G4s were determined.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Friedman

Terentis

2015

J. Raman Spectrosc.

View full text Add to dashboard Cite

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)4‐3′, and a modified c‐Myc NHE‐III1 sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na+ or K+, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm−1 and 1420–1460 cm−1 spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm−1) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.

show abstract

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Friedman

Terentis

2015

J. Raman Spectrosc.

View full text Add to dashboard Cite

show abstract

“…разбавляли буфером (10 мМ KCl, 0,5 мМ Трис-HCl, pH 7,5) в 100-2000 раз, наносили на поверхность модифицированного графита. Сканирование проводили с помощью АСМ-микроскопа ("NT-MDT", Россия) по методу [13].…”

Section: атомно-силовая микроскопия (асм)unclassified

Conformational polymorphysm of G-rich fragments of DNA Alu-repeats. II. the putative role of G-quadruplex structures in genomic rearrangements

et al. 2016

View full text Add to dashboard Cite

Three evolutionary conserved sites of Alu repeats (PQS2, PQS3 and PQS4) were shown to form stable inter- and intramolecular G-quadruplexes (GQs) in vitro. Structures and topologies of these GQs were elucidated using spectral methods. Self-association of G-rich Alu fragments was studied. Dimeric GQ formation from two distal identical or different putative quadruplex sites – (PQS2)2, (PQS3)2 or PQS2-PQS3 – within one lengthy DNA strand was demonstrated by a FRET-based method. Oligomer PQS4 (folded into a parallel intramolecular GQ) was shown to form stacks of quadruplexes that are stabilized by stacking interactions of external G-tetrads (this was confirmed by DOSY NMR, AFM microscopy and differential CD spectroscopy). Comparative analysis of the properties of various GQs allowed us to put forward a hypothesis of two general mechanisms of intermolecular GQ-dependant genomic rearrangements: 1) formation of a dimeric GQs; 2) association of pre-folded intramolecular parallel GQs from different strands into GQ-stacks. Thus, the observed co-localization of G-rich motifs of Alu elements with double-strand break hotspots and rearrangement hotspots may be accounted for by the specific secondary structure of these motifs. At the same time, this is likely primarily due to high abundance of such G-rich Alu fragments in the genome.

show abstract

“…For example, alternating addition of Ni 2+ and Na 2 EDTA can cycle the G-wire between higher order and disorganized structures [66]. For frayed wires, incorporation of the isoelectronic guanine analog pyrazolo [3,4,-d]pyrimidine (PPG) into d(A 15 G 15 ) inhibits wire formation [67].…”

Section: Higher Order Structures Based On Tetramolecular G-quadruplexesmentioning

confidence: 99%

Assembly of chemically modified G-rich sequences into tetramolecular DNA G-quadruplexes and higher order structures

Zhou

Rosu

Amrane

et al. 2014

Methods

View full text Add to dashboard Cite

In this review, we introduce the biophysical and biochemical methods currently used to investigate the structures and stabilities of tetramolecular DNA G-quadruplexes containing chemical modifications. We hope this paper will guide others as they perform similar experiments leading to more information about the effects of chemical modifications on G-quadruplex formation. The structures of tetramolecular quadruplexes and some higher order structures based on tetramolecular quadruplexes are also described.

show abstract

A study of the interactions that stabilize DNA frayed wires

Cited by 18 publications

References 39 publications

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Analysis of G-quadruplex conformations using Raman and polarized Raman spectroscopy

Conformational polymorphysm of G-rich fragments of DNA Alu-repeats. II. the putative role of G-quadruplex structures in genomic rearrangements

Assembly of chemically modified G-rich sequences into tetramolecular DNA G-quadruplexes and higher order structures

Contact Info

Product

Resources

About