A heterotrimeric G protein complex couples the muscarinic m1 receptor to phospholipase C-beta.

Dippel, Edgar; Kalkbrenner, Frank; Wittig, Burghardt; Schultz, Günter

doi:10.1073/pnas.93.4.1391

Cited by 75 publications

(69 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The results of these experiments revealed that the time course by which anti-␣ q or anti-␣ 11 antisense oligonucleotides were effective in suppressing functional receptor-mediated effects paralleled suppression of the G␣ q or G␣ 11 protein level which decreased maximally within 3 days after injection. Similar results were recently obtained using ␣ o -, ␣ i -, and ␣ q /␣ 11 -antisense oligonucleotides in different cells (8,12,30). In addition, we demonstrated that injection of antisense oligonucleotides directed against a given G protein subunit did not modify significantly the expression of other G protein subunits (see Fig.…”

Section: Discussionsupporting

confidence: 76%

“…Thus, the ubiquitously expressed G␣ q family may have a general role in modulating Ca 2ϩ entry through Ca 2ϩ -permeable nonselective cation channels which may be controlled by both the filling state of Ca 2ϩ stores (38) and, as shown here, more directly by G protein. Recently, the composition of G proteins coupling the stably expressed human muscarinic m 1 receptor in the rat basophilic leukemia cell line (RBL-2H3-hm1) to increase in [Ca 2ϩ ] i has been determined by using the same method and the same antisense oligonucleotides (12). In these cells, the authors have proposed that a complex of G protein subunits, i.e.…”

Section: Discussionmentioning

confidence: 99%

“…The sequences of anti-␣ ocom , anti-␤ 1 , anti-␤ 2 , anti-␤ 3 , anti-␤ 4 , anti-␥ 1 , anti-␥ 4 , and anti-␥ 5 antisense oligonucleotides have been previously published (11). The sequences of the anti-␣ q , anti-␣ 11 , and anti-␣ 14 have been published (12). The sequence of anti-␣ q/11com is ATGGACTCCAGAGT and that of sense ␣ q/11com is ACTCTGGAGTCCAT corresponding to nt 4 -17 of ␣ q cDNA (14), of scrambled anti-␣ q/11com is TACGGTCCAGAGTA corresponding to a scrambled sequence of nt 4 -17 of ␣ q cDNA, of anti-␣ 12 is CTCCGGC-CTCGGCCGGCAGCAAGC corresponding to nt 32-55 of ␣ 12 cDNA (15), of anti-␤ 5 is TGCCATCTTCGTCCGGATGCAGCC corresponding to nt (Ϫ18)-(ϩ6) of ␤ 5 cDNA (16), of anti-␥ 2 is TTCCTTGGCATGCGCTTCAC corresponding to nt 122-141 of ␥ 2 cDNA (17), of anti-␥ 3 is GTTCTC-CGAAGTGGGCACAGGGGT corresponding to nt 165-188 of ␥ 3 cDNA (18), of anti-␥ 7 is CTGGGCGACGTTGTTAGTACCTGA corresponding to nt 7-30 of rat ␥ 7 cDNA (19), of anti-␥ 8 is GCGGGCCTCAGCGAT CTTGGCCAT corresponding to nt 13-36 of ␥ 8 cDNA (20).…”

Section: Methodsmentioning

confidence: 99%

“…Studies with this method in GH 3 cells have revealed that the M 4 muscarinic receptor in GH 3 cells couples to the G protein trimer consisting of ␣ o1 ␤ 3 ␥ 4 , the somatostatin receptor to the trimer ␣ o2 ␤ 1 ␥ 3 , and the galanin receptor to the trimers ␣ o1 ␤ 2 ␥ 2 and ␣ o1 ␤ 3 ␥ 4 to inhibit voltage-dependent Ca 2ϩ channels (8 -11). In RBL-2H3-hm1 cells, G proteins composed of G␣ q /␣ 11 ⅐␤ 1 /␤ 4 ⅐␥ 4 are required for effective coupling between the stably expressed human muscarinic m 1 receptor and cellular increase in [Ca 2ϩ ] i (12).…”

mentioning

confidence: 99%

See 3 more Smart Citations

Distinct Functions of Gq and G11 Proteins in Coupling α1-Adrenoreceptors to Ca2+ Release and Ca2+ Entry in Rat Portal Vein Myocytes

Macrez¹,

Kalkbrenner²,

Schultz³

et al. 1997

Journal of Biological Chemistry

View full text Add to dashboard Cite

In this study, we identified the subunit composition of G q and G 11 proteins coupling ␣ 1 -adrenoreceptors to increase in cytoplasmic Ca 2؉ concentration ([Ca 2؉ ] i ) in rat portal vein myocytes maintained in short-term primary culture. We used intranuclear antisense oligonucleotide injection to inhibit selectively the expression of subunits of G protein. Increases in [Ca 2؉ ] i were measured in response to activation of ␣ 1 -adrenoreceptors, angiotensin AT 1 receptors, and caffeine. Antisense oligonucleotides directed against the mRNAs coding for ␣ q , ␣ 11 , ␤ 1 , ␤ 3 , ␥ 2 , and ␥ 3 subunits selectively inhibited the increase in [Ca 2؉ ] i activated by ␣ 1 -adrenoreceptors. A corresponding reduction of the expression of these G protein subunits was immunochemically confirmed. In experiments performed in Ca 2؉ -free solution only cells injected with anti-␣ q antisense oligonucleotides displayed a reduction of the ␣ 1 -adrenoreceptor-induced Ca 2؉ release. In contrast, in Ca 2؉ -containing solution, injection of anti-␣ 11 antisense oligonucleotides suppressed the ␣ 1 -adrenoreceptor-induced stimulation of the store-operated Ca 2؉ influx. Agents that specifically bound G␤␥ subunits (anti-␤ com antibody and overexpression of a ␤-adrenergic receptor kinase carboxyl-terminal fragment) had no effect on the ␣ 1 -adrenoreceptor-induced signal transduction. Taken together, these results suggest that ␣ 1 -adrenoreceptors utilize two different G␣ subunits to increase [Ca 2؉ ] i . G␣ q may activate phosphatidylinositol 4,5-bisphosphate hydrolysis and induce release of Ca 2؉ from intracellular stores. G␣ 11 may enhance the Ca 2؉ -activated Ca 2؉ influx that replenishes intracellular Ca 2؉ stores.In vascular smooth muscle, activation of ␣ 1 -adrenoreceptors stimulates phospholipase C-␤ which hydrolyzes phosphatidylinositol-4,5-bisphosphate to yield diacylglycerol and inositol 1,4,5-trisphosphate. In portal vein myocytes, the ␣ 1A -adrenoreceptors are coupled to phospholipase C-␤ through G proteins which have been identified to be G q and/or G 11 , on the basis of intracellular applications of an anti-G␣ q /␣ 11 antibody. Inositol 1,4,5-trisphosphate subsequently releases Ca 2ϩ from the intracellular store. Diacylglycerol in concert with cellular Ca 2ϩ activates protein kinase C which, in turn, stimulates Ca 2ϩ influx through voltage-dependent Ca 2ϩ channels (1-2). In addition, depletion of the intracellular store by norepinephrine promotes a sustained Ca 2ϩ entry through dihydropyridine-resistant Ca 2ϩ channels by an unknown mechanism (3). Both norepinephrine-induced Ca 2ϩ release and Ca 2ϩ entry lead to a biphasic rise of the cytoplasmic Ca 2ϩ concentration ([Ca 2ϩ ] i ). 1 Although the G protein subtypes are currently defined by their ␣ subunits, of which 23 (including splice variants) are known, a functionally active heterotrimeric G protein includes an ␣, ␤, and ␥ subunit. Up to now, 5 different ␤ and 11 different ␥ subunits have been identified (4). Thus, a great number of heterotrimers composed of specific ␣, ␤, and...

show abstract

Section: Discussionsupporting

confidence: 76%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Distinct Functions of Gq and G11 Proteins in Coupling α1-Adrenoreceptors to Ca2+ Release and Ca2+ Entry in Rat Portal Vein Myocytes

Macrez¹,

Kalkbrenner²,

Schultz³

et al. 1997

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…The PH domain of PLC-β2 exhibits high affinity for Gβγ subunits bound to membranes (59). Experiments with antisense oligonucleotides directed to mRNAs encoding various G protein subunits suggested that the m1 muscarinic acetylcholine receptor interacts only with G protein complexes composed of the subunits αq, α11, β1, β4, and γ 4 in order to activate PLC in RBL-2H3 cells, despite the fact that the subunits α14, β2, β3, γ2, γ3, γ5, and γ7 are also expressed in these cells (60). G protein-initiated signaling is turned off by hydrolysis of the GTP bound to the Gα subunit, a reaction catalyzed by the intrinsic GTPase activity of the α subunit itself, and the subsequent reassociation of the GDP-bound α subunit with the βγ subunits.…”

Section: Plc-β Isozymesmentioning

confidence: 99%