A combinatorial systematic evolution of ligands by exponential enrichment method for selection of aptamer against protein targets

Abstract

Aptamers are synthetic DNA recognition elements which form unique conformations that enable them to bind specifically to their targets. In the present study, an attempt was made to standardize a new modified combinatorial method comprising of Ni-NTA affinity Systematic Evolution of Ligands by Exponential Enrichment (SELEX; based on affinity between His tag protein and Ni-NTA), membrane SELEX (based on immobilization of protein on nitrocellulose membrane), and microtiter plate based SELEX (to monitor affinity and to enrich the selected aptamers) for protein targets. For experimental evaluation, staphylococcal interotoxin B was the molecule chosen. The new combinatorial method enhanced selection ability up to 51.20 % in comparison with individual conventional procedures. Employing this method following six rounds of selection, high-affinity aptamers with very different properties could be obtained with a dissociation constant (K d) value as low as 34.72 ± 25.09 nM. The optimal aptamers could be employed in fluorescence binding assay, enzyme-linked oligonucleotide assays, and aptamer-based Western blot assay for characterization and detection. These results pave a potential path without using of any robotics for high-throughput generation of aptamers with advantages in terms of rapidity, simplicity, and ease in handling.

Highly Sensitive Colorimetric Biosensor for Staphylococcal Enterotoxin B by a Label-Free Aptamer and Gold Nanoparticles

“…Higher response was observed within the range of 10–30°C, and the response decreased at 30°C, this could be due to loss of secondary structure of aptamer at high temperature. Taking consideration of aptamer selection condition and most probable secondary (Figure S3 ) structure (Mondal et al, 2015 ), room temperature (27°C) was chosen as the suitable temperature for all experiments.…”

“…Synthesized single-stranded DNA (ssDNA) aptamer (SEB2) 5′TAGCTCACTCATTAGGCACGGGTAGGCCATAATATCTTATTAGCGTAATTCTGCGATTGGCATAGTTAAGCCAGCC3′ (Mondal et al, 2015 ) and random ssDNA (RDNA) 5′CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT3′ were obtained from Xcelris Bioscience (Ahmadabad). DNA stock solution was prepared in 10 mM DPBS (pH 7.0) and was stored at 4°C before use.…”

“…However, we were unaware of any exclusive study discussing on aptamer-AuNPs based colorimetric assay for detection of SEB. In our previous report we have reported a single-stranded DNA aptamer (SEB2) that binds to enterotoxin B and able to detect in low nanomolar range (Mondal et al, 2015 ).…”

Immuno Affinity SELEX for Simple, Rapid, and Cost-Effective Aptamer Enrichment and Identification against Aflatoxin B1

“…In order to generate ssDNA, asymmetric PCR amplification (Mondal et al, 2015) of aptamer library was carried out with each reaction consisting of 4 μl of 1X PCR buffer, 3.2 μl of 1.6 mM MgCl 2 , 2 μl of 0.2 mM dNTPs, 0.4 μl of 2U/μl of Taq DNA polymerase, 1 μl of template library, 27.4 μl of distilled water and different ratios of forward to reverse primers (1.1:0.9, 1.2:0.8, 1.3:0.7, 1.4:0.6, 1.5:0.5, 1.6:0.4, 1.7:0.3, 1.8:0.2, 1.9:0.1, and 2.0:0). The PCR was performed in thermocycler (Bio-Rad, India) with following amplification conditions: initial denaturation at 94°C for 5 min and 30 cycles of 94°C for 45 s, 56°C for 45 s, 72°C for 45 s and final extension at 72°C for 8 min.…”

“…The eluted DNA was amplified by earlier standardized PCR conditions and used in subsequent rounds of SELEX. The concentration and specificity of ssDNA pool toward AFB1 from each round was monitored by Nanodrop-2000 (Thermo Scientific, India) and ELONA (Mondal et al, 2015) using biotin-labeled aptamer pool (Supporting Information 4). To enhance the specificity of the aptamers, counter SELEX was introduced after 3rd, 5th, and 7th rounds.…”