A case of mistaken identity? Vaccinia virus in a live camelpox vaccine

Yousif, Ausama; Al-Ali, Ahmed M.

doi:10.1016/j.biologicals.2012.05.001

Cited by 6 publications

(14 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We selected three genes to represent different regions on the CMLV genome; the ATIP gene region which, was used to determine the species of the OPXV via PCR by producing amplicons of different sizes ( Meyer et al , 1994 ) or VACV similar sequence ( Yousif and Al Ali, 2012 ), second, we targeted the L1R gene IMV gene of ORXV also used by Yousif and Al Ali (2012) , additionally, a unique region in the CMLV genome which encode open reading frame (ORF) 185 claimed absent in other OPXVs ( Afonso et al , 2002 ) was used.…”

Section: Methodsmentioning

confidence: 99%

“…To corroborate the ATIP gene results, we amplified two more CMLV genes. First, IMV gene (L1R) was followed as previously described ( Yousif and Al Ali, 2012 ). Second, a unique region in the CMLV genome which encode ORF 185 absent in other OPXVs ( Afonso et al , 2002 ) was used for PCR primer design, namely 185F forward sequence 5’ CTCAATGAGAGTTCCTGACCATCC 3’ and 185R reverse 5’ ACACTCTAATACAACACAGGCAACA 3’ that amplify a 923 bp product.…”

Section: Methodsmentioning

confidence: 99%

“…The present study was prompted by the interesting findings of Yousif and Al Ali (2012) on the mistaken identity of Al Jouf-78 CMLV vaccine.…”

Section: Introductionmentioning

confidence: 99%

“… Yousif and Al Ali (2012) surprisingly obtained a PCR fragment longer than 881 bp by using the consensus ATIP gene primers to identify CMLV in Jouf CMLV vaccine produced in Saudi Arabia. They sequenced the ATIP, two extracellular enveloped viruses-specific (A33R and B5R), and two intracellular mature virus (IMV) (L1R and A27L) orthologue genes and these sequences were found like VACV Lister strain.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

More cell culture passaged Camelpox virus sequences found resembling those of vaccinia virus

Khalafalla¹,

Hosani

Ishag

et al. 2020

Open Vet J.

View full text Add to dashboard Cite

Background: Camelpox is the most infectious and economically important disease of camelids that causes significant morbidity and mortality rates. Several live attenuated vaccines against Camelpox virus (CMLV) are produced worldwide by passaging field isolates in cell culture. Sequence of a high passage Saudi isolate of CMLV was previously found closely resembled Vaccinia virus (VACV).Aim: To determine whether other high cell culture passage CMLV isolates are genetically resemble VACV and further to explore the possible mechanism of the resemblance.Methods: We performed polymerase chain reaction and DNA sequence analysis of A-type inclusion body protein (ATIP), L1R, and open reading frame (ORF) 185 genes on different cell culture passage levels of a field isolate, two high passage vaccines, wild-type, and reference strains of CMLV.Results: We demonstrate that additional two high passage attenuated vaccine candidate from Sudan and UAE likewise contain sequences resembling VACV more than CMLV. Furthermore, sequence analysis of the ATIP gene of selected virus passages in cell culture revealed that the shift to VACV-like occurred between passage 11 and 20 and up to the 10th passage the genome still resembles wild-type virus. This observation was further confirmed by recombination analysis which indicated recombination events at ATIP and ORF185 genes occurred at higher passages.Conclusion: We confirmed that the cell culture passage CMLV turns to resemble VACV after cell culture passage and concluded that the resemblance may not be a result of contamination or misidentification as previously thought but could be due to recombination events that occurred during the passage process. Keywords: Camelpox virus, cell culture passage, phylogenetic analysis.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

“…The present study was prompted by the interesting findings of Yousif and Al Ali (2012) on the mistaken identity of Al Jouf-78 CMLV vaccine.…”

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

More cell culture passaged Camelpox virus sequences found resembling those of vaccinia virus

Khalafalla¹,

Hosani

Ishag

et al. 2020

Open Vet J.

View full text Add to dashboard Cite

show abstract

“…Ducapox live attenuated vaccine is manufactured in South Africa, T8 killed vaccine in Morocco, and the Jouf-78 has been used to produce live attenuated vaccine in Saudi Arabia (9). Recently, it was discovered that the Jouf-78 vaccine contained a vaccinia virus (VACV) rather than CMLV (13); consequently, the production of this vaccine has ceased.…”

Section: Introductionmentioning

confidence: 99%

Development and evaluation of a live attenuated camelpox vaccine from a local field isolate of the virus

Abdellatif¹,

Ibrahim²,

Khalafalla³

2014

Rev. Sci. Tech. OIE

View full text Add to dashboard Cite

A strain of camelpox virus (CMLV) isolated in the Sudan was attenuated by serial passage in Vero cell monolayers for use as a future vaccine strain. The safety and potency of passage 115 virus (designated Sudan CMLV/115) was tested. Camels inoculated with CMLV/115 showed no clinical disease or skin lesions, developed low-level antibodies and cell-mediated immune response and resisted challenge with virulent wild-type CMLV. Field testing of the candidate vaccine showed that the developed vaccine induces immune response and is safe for young and pregnant camels.

show abstract

Another case of mistaken identity? Vaccinia virus in another live Camelpox vaccine

Saud

Butt

2020

Biologicals

View full text Add to dashboard Cite

Camelpox virus is the causative agent of Camelpox, a highly contagious disease of camels. A high passage Camelpox virus strain has previously been reported to contain several genes which more closely resemble Vaccinia, a virus species with no known natural host, encompassing various strains that show high inter-strain genomic variation. In this study, we demonstrate that yet another high passage, live attenuated vaccine, comprising a different strain of Camelpox virus, contains genomic sequences that match a differing strain of Vaccinia virus. These results are discussed in the context of hypotheses put forward to explain the unknown origins of Vaccinia virus, suggesting further studies to elucidate evolutionary trajectories of Orthopoxviruses through passaging.

show abstract

A case of mistaken identity? Vaccinia virus in a live camelpox vaccine

Cited by 6 publications

References 11 publications

More cell culture passaged Camelpox virus sequences found resembling those of vaccinia virus

More cell culture passaged Camelpox virus sequences found resembling those of vaccinia virus

Development and evaluation of a live attenuated camelpox vaccine from a local field isolate of the virus

Another case of mistaken identity? Vaccinia virus in another live Camelpox vaccine

Contact Info

Product

Resources

About