In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Abstract

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Prevalence of Listeria monocytogenes, E. coli, Salmonella Spp. and Staphylococcus aureus Bacteria Contamination on Meat at Public Market in the North of Vietnam

“…and Staphylococcus aureus in beef, pork, and poultry varied by sample collection time during the day in studied sites (P < 0.05). The results were lower than those on Listeria monocytogenes contamination, with 40% of the samples found positive on poultry, red meat and meat products; and with 47.7% of the beef samples found positive with Listeria monocytogenes; and were in line with those in Saudi Arabia and Egypt with 12% to 38% of the beef samples found positive with Staphylococcus aureus; in line with those, who successfully isolated Escherichia coli from beef (27.7%) and used water (2.3%); with those with 4.6% of the beef samples found positive with Salmonella typhimurium of [20,24,37,5,1].…”

“…With P < 0.05, we can see a statistical variance on that the differences were statistically significant on contamination of Listeria monocytogenes on beef in different time frame of sample collection during the day. The results were lower on that Listeria monocytogenes contamination, with 40% of the samples found positive on poultry, red meat and meat products; and with 47.7% of the beef samples found positive with Listeria monocytogenes [20,24].…”

“…From table 20 we can see that 116 strains of Staphylococcus aureus possessed the DNA with the encoded gene producing SEB (79.4%);30 strains did not possess the gene (20.5%). The results were in line with those in the studies on Staphylococcus aureus on meat and the results on determination of SEB produced by this type of bacteria of [11,22,23].…”

“…However, they were lower than those of with 100% on enterotoxin Stn production and 100% invA invasion [4] ( Figure 2). Table 23 presented the results of determination of the number of strains possessing the encoded gene LLO (hlyA) of Listeria monocytogenes isolates; It was found that with Listeria monocytogenes on beef, 7/32 strains possessed gene hlyA, accounting for 21.8%; on pork, there were 9/40 strains, accounting for 22.5%; on chicken meat, there were 11/32 strains, accounting for 34.3% [20,25,38] (Figure 3). There were 21/27 strains of Listeria monocytogenes resisting to amoxicilline, accounting for 77.77%; 1/27 strains resisting to nitrofurantoin, ceftazidime, oxytetracycline, accounting for 3.70%; 3/27 strains resisting to erythromycin, accounting for 11.11%; None of the strains (0%) were resistant to vancomycin and oxacillin; 2/27 strains resisting to rifampicin, accounting for 7.40%; 5/27 strains resisting to gentamicin, accounting for 18.51%; 3/27 strains resisting to bacitracin, accounting for 11.11%; 4/27 strains resisting to nalidixic acid (14.81%).…”

Molecular Characterization of Listeria monocytogenes in white meat samples from Punjab, India

“…A study in meat samples from butcheries in Bareilly, (U.P.) India revealed that 6% of the chicken samples were contaminated with L. monocytogenes (Khan et al, 2013). In Goa in Southern India, L. monocytogenes was isolated from 8.l% poultry meat samples (Barbuddhe et al, 2003).…”