Anatomical features of the urethra and urinary bladder catheterization in female mice and rats. An essential translational tool

Reis, Leonardo Oliveira; Sopena, J.M. Gaya; Fávaro, Wagner José; Martin, Mireia Castilho; Simão, Antônio Felipe; Reis, Rodolfo Borges dos; Andrade, Murilo Ferreira de; Domenech, Josep Domingo; Cardó, Carlos Cordón

doi:10.1590/s0102-86502011000800019

Cited by 35 publications

(27 citation statements)

References 6 publications

(10 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…For mouse urinary tract infection analyzes were used 6-8 weeks-old female BALB/c mice (CEMIB, UNICAMP, Brazil). Infections were carried out by transurethral inoculation as previously described (46,47). UKP8 and kpfR::kan R strains were grown on LB agar plates at 37°C for 18 h and resuspended at a concentration of 5 x 495-496 CATCATATTGCTAAGGTCGGTGGCCTGA GC-intron-AATTTTCTTATTATT 9.52 0,034…”

Section: Discussionmentioning

confidence: 99%

Functional insights from KpfR, a new transcriptional regulator of fimbrial expression that is crucial for Klebsiella pneumoniae pathogenicity

Gomes¹,

Pacheco²,

Santos³

et al. 2020

Preprint

View full text Add to dashboard Cite

Although originally known as an opportunistic pathogen, Klebsiella pneumoniae has been considered a worldwide health threat nowadays due to the emergence of hypervirulent and antibiotic-resistant strains capable of causing severe infections not only on immunocompromised patients but also on healthy individuals. Fimbriae is an essential virulence factor for K. pneumoniae, especially in urinary tract infections, because it allows the pathogen to adhere and invade urothelial cells and to form biofilms on biotic and abiotic surfaces. The importance of fimbriae for K. pneumoniae pathogenicity is highlighted by the large number of fimbrial gene clusters on the bacterium genome, which requires a coordinated and finely adjusted system to control the synthesis of these structures. In this work, we describe KpfR as a new transcriptional repressor of fimbrial expression in K. pneumoniae and discuss its role in the bacterium pathogenicity. K. pneumoniae lacking the kpfR gene exhibited a hyperfimbriated phenotype with enhanced biofilm formation and greater adhesion to and replication within epithelial host cells. However, the mutant strain was attenuated for colonization of the bladder in a murine model of urinary tract infection. These results indicate that KpfR is an important transcriptional repressor that, by negatively controlling the expression of fimbriae, prevents K. pneumoniae from having a hyperfimbriated phenotype and from being recognized and eliminated by the host immune system.IMPORTANCEFimbriae are crucial virulence factor for many pathogens because they allow the pathogen to adhere and invade host cells and to form biofilm on biotic and abiotic surfaces. However, the synthesis of fimbriae requires a precise and coordinated control to guarantees the production of these structures only when necessary, thus avoiding unnecessary energy expenditure and bacterial clearance by the host immune cells. Herein, we describe for the first time the role of the transcriptional repressor of fimbrial expression KpfR on the pathogenicity of K. pneumoniae, a Gram-negative pathogen that has gained worldwide attention, notably for being the causative agent of severe and metastatic infections even on healthy individuals. By deleting the kpfR gene, we show that the mutant strain loses the control of fimbriae production, resulting in a hyperfimbriated phenotype that impairs K. pneumoniae ability to colonize a murine model of urinary tract infection.

show abstract

Section: Discussionmentioning

confidence: 99%

Functional insights from KpfR, a new transcriptional regulator of fimbrial expression that is crucial for Klebsiella pneumoniae pathogenicity

Gomes¹,

Pacheco²,

Santos³

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…Five mice were employed in each group viz., P. mirabilis (Pet+), EAEC 042 (Pet+), P. mirabilis (Pet-) and a control group remained uninfected (inoculated only with PBS). Mice were anesthetized with ketamine [60mg/Kg] and xilazine [10mg/Kg], and transurethral inoculated with 50 μL of the corresponding bacterial suspension containing approximately 5X10 7 CFU (Reis et al, 2011;Hung, Dodson & Hultgren, 2009).…”

Section: Urinary Tract Infectionmentioning

confidence: 99%

Alteraciones en el tracto urinario durante la infección con Proteus mirabilis que expresa la toxina codificada en plásmido (Pet)

et al. 2019

View full text Add to dashboard Cite

La toxina Pet (plasmid-encoded toxin) producida por Escherichia coli (EAEC) es uno de los autotransportadores más estudiados en la familia Enterobacteriaceae.Es responsable de cambios morfológicos enenterocitos durante la infección por EAEC. Recientemente, Pet fue encontrada en el genoma de una cepa de Proteus mirabilis RTX339 [P. mirabilis (Pet+)]. P. mirabilis causa infección en el tracto urinario (ITU) en pacientes que usan catéteres o que presentan anomalías estructurales o funcionales. En este estudio una ITU con P. mirabilis (Pet+) fue inducida en ratones hembras BALB/c. Los ratones infectados con P. mirabilis (Pet+) muestran una colonización bacteriana en vejiga y riñón desde el segundo hasta el día decimo de la infección. Los cambios morfológicos fueron evidenciados por histología. Se observaron múltiples células exfoliadas del epitelio de transición de la vejiga, así como alteraciones morfológicas en la corteza renal. Se confirmó la presencia de Pet en las células exfoliadas y en las del parénquima por microscopíaconfocal. Las alteraciones del citoesqueleto fueron observadas en los sitios donde se detectó Pet. La toxina Pet expresada por la cepa de P. mirabilis (Pet+) contribuye a la patogenicidad y afecta tejidos urinarios durante el curso de la infección.

show abstract

“…Most UTUCs are found to be invasive at diagnosis, whereas most bladder urothelial cancers are non‐muscle invasive. Though it corresponds to approximately 10% of all human urothelial cancers, extrapolating data from the other 90% (mainly bladder cancer) might deter the advancement of UTUC knowledge and management …”

Section: Advantages and Disadvantages Of Diverse Animal Modelsmentioning

confidence: 99%

“…Although they are strong tools, there is no perfect animal model. The restriction to female animals to allow intravesical drug delivery, limiting off‐target effects in an extraordinary example of direct therapeutics administration against solid tumor, it impedes the male microenvironment because of the challenges related to the common duct for reproduction and urinary functions in males …”

Section: Advantages and Disadvantages Of Diverse Animal Modelsmentioning

confidence: 99%

Editorial Comment to Orthotopic mouse model of renal pelvic cancer using a human bladder cancer cell line

Reis

2016

Int J of Urology

View full text Add to dashboard Cite

Anatomical features of the urethra and urinary bladder catheterization in female mice and rats. An essential translational tool

Cited by 35 publications

References 6 publications

Functional insights from KpfR, a new transcriptional regulator of fimbrial expression that is crucial for Klebsiella pneumoniae pathogenicity

Functional insights from KpfR, a new transcriptional regulator of fimbrial expression that is crucial for Klebsiella pneumoniae pathogenicity

Alteraciones en el tracto urinario durante la infección con Proteus mirabilis que expresa la toxina codificada en plásmido (Pet)

Editorial Comment to Orthotopic mouse model of renal pelvic cancer using a human bladder cancer cell line

Contact Info

Product

Resources

About