Sensibility of the PCR technique in the detection of Stenocarpella sp. associated with maize seeds

Abstract

-Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. the use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. the seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.the primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.Index terns: fungus, molecular detection, stalk and ear rot, macrospore leaf spot.Sensibilidade da técnica PCR na detecção de Stenocarpella sp. associados às sementes de milho RESuMo -Sementes de milho infectadas por Stenocarpella são importantes fontes de inóculo para a introdução e disseminação da podridão do colmo e da espiga e mancha foliar de macrospora em campos de produção. o uso de sementes sadias constitui uma importante estratégia para o controle preventivo dessas doenças. A disponibilidade de métodos rápidos para a detecção desses fungos em análises de rotina é uma das dificuldades em programas de controle de qualidade de sementes de milho, já que o método utilizado demanda longo tempo e sua identificação é bastante subjetiva. o objetivo desse trabalho foi investigar o uso da técnica PCR para a detecção desses patógenos em sementes de milho. Para isto sementes de milho inoculadas com S. maydis foram misturadas a sementes sadias de modo que formassem lotes com incidências de 100, 20, 10, 2, 1 e zero%. o par de primers utilizado para detectar S. maydis foi capaz de detectar o máximo de 2% de incidência, todavia os primers não foram suficientes para diferenciar as duas espécies.termos para indexação: fungo, detecção molecular, podridão do colmo e da espiga, mancha foliar de macrospora.

Effects of Stenocarpella maydis in seeds and in the initial development of corn

“…It is known that S. maydis fungus is responsible for fi eld losses caused by decay of the stem, death of seeds / seedlings and can produce toxins harmful to human and animal consumption (Odriozola et al, 2005). By the results obtained in this study, it was also evident that the association of this pathogen with corn seeds can impair the quality of seeds and also the early development of seedlings from seeds infected by the fungus, with increasing and proportional effects to the values of potential of initial inoculum in seeds (Barrocas et al, 2012;Casa et al, 2006). It was possible to confi rm the signifi cant harmful effects caused by this pathogen on corn seeds.…”

“…In the three variables occurred inversely proportional results to the inoculum potentials imposed by the different contact times of the seeds with the pathogens (Araújo et al, 2006;Botelho et al, 2013;Moraes and Menten, 2006;Sartori et al, 2004).…”

Contribution of organic amendments to soil properties and survival of Stenocarpella on maize stalk

“…DNA extraction was performed using the Genomic DNA Purification Wizard® kit (PROMEGA, Madison, WI) following the protocol of the manufacturer's recommendations. The qPCR was performed on a rotor-gene 6500 (Corbett Research, Montlake, Australia) according to the methodology proposed by Xia and Achar (2001) using SYBR Green PCR Kit (Qiagen), and primers P1 and P2 (P1/2 (GTTGGGGGTT-TAACGGCACG/GTTGCCTCGGCACAGGCCGG) specific for the genus Stenocarpella to detect the presence of fungus in the stalk samples (Barrocas et al, 2012;Siqueira et al, 2014;Xia and Achar, 2001). For each reaction, a 2.0-μL sample of Stenocarpella spp.…”

Citric acid production and citrate synthase genes in distinct strains of Aspergillus niger

“…The primers ITS 1 and ITS 4 were utilized also to warrant the quality of DNA. According to Barrocas et al (2012) and Phan et al (2002), the regions of ITS of rDNA have been widely utilized to distinguish and detect closely related fungal species. According to White et al (1990), the ITS region is easily amplified, since it is comprehended between 600 and 800 pairs of base.…”