BackgroundNormally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications.ResultsThe search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3’UTR (214 sites), CDS (3 sites), and 5’UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3’UTRs. The miR-619-5p binding site in the 5’UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3’UTRs of all human target genes are also present in the 3’UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes.ConclusionsThe majority of miR-619-5p binding sites are located in the 3’UTRs but some genes have miRNA binding sites in the 5’UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3’UTRs, 5’UTRs and CDSs are conservative in the orthologous mammalian genes.Electronic supplementary materialThe online version of this article (doi:10.1186/s12864-017-3811-6) contains supplementary material, which is available to authorized users.

The importance of miRNA in cellular regulation is gaining momentum. Therefore, it is of interest to study miRNA in human genes. Hence, the humanmRNA sequences (12,175) were searched for miRNA binding sites and 2,563predicted sites were found. We observed that the miR-3960 has more than 1000mRNA binding sites with high affinity (with ΔG/ΔGm values greater than or equal to 90%) for 375genes. The miR-3960 has 565 binding sites in the 5'UTRs and 515 sites in theCDS of mRNAs. Nucleotide sequences of the binding sites in CDS encode for polyalanine orpolyproline. It is observed that miR-3960 has binding sites in 73 mRNAs of target genesencoded transcription factors. Thus, we document predictedproperties (polysites, sites in CDS) of uncharacterized miR-3960 binding sites. The studying of the miRNA properties is important for creation of diagnostic methods of cancer.

This study examined binding sites of 2,578 miRNAs in the mRNAs of 12,175 human genes using the MirTarget program. It found that the miRNAs of miR-1273 family have between 33 and 1,074 mRNA target genes, with a free hybridization energy of 90% or more of its maximum value. The miR-1273 family consists of miR-1273a, miR-1273c, miR-1273d, miR-1273e, miR-1273f, miR-1273g-3p, miR-1273g-5p, miR-1273h-3p, and miR-1273h-5p. Unique miRNAs (miR-1273e, miR-1273f, and miR-1273g-3p) have more than 400 target genes. We established 99 mRNA nucleotide sequences that contain arranged binding sites for the miR-1273 family. High conservation of each miRNA binding site in the mRNA of the target genes was found. The arranged binding sites of the miR-1273 family are located in the 5′UTR, CDS, or 3′UTR of many mRNAs. Five repeating sites containing some of the miR-1273 family's binding sites were found in the 3′UTR of several target genes. The oligonucleotide sequences of miR-1273 binding sites located in CDSs code for homologous amino acid sequences in the proteins of target genes. The biological role of unique miRNAs was also discussed.

The change in the composition of camel milk in four dromedaries was studied by including the common measured parameters: protein, total fat, lactose, main minerals (calcium, phosphorus, and iron), and vitamin C. The fat matter varied from 4.34% to 7.81% with a slight decrease all along the lactation and a minimal value at the 14th week corresponding to the lactation peak. Those variations were less important for protein content (from 2.58% to 3.64%), but the minimal value was observed at the 14th week also. The lactose varied slightly around its mean of 3.46%. The vitamin C concentration varied from 48 to 256 mg/l with a tendency of increasing all along the lactation. Calcium and phosphorus concentrations were quite parallel and their ratio Ca/P was constant. The minimal values (1.43 g/l for calcium and 1.16 g/l for phosphorus) were observed at the beginning of the lactation. The iron concentrations varied around the mean of 1.73 mg/l.

Transcription factor gene ZFHX3 is one of the candidate genes involved in stroke development. The ZFHX3 protein contains oligopeptides encoded by trinucleotide repeats (TNRs). TNR variability is considered to be one of the causes of the disease, but their biological function has not yet been established. We assume that TNRs are the binding sites of miRNA to mRNA and are involved in regulation of ZFHX3 gene expression. The characteristics of miRNA–mRNA interaction were determined using MirTarget software. It has been shown that the first TNR in mRNA of the human ZFHX3 gene consists of the seven consecutive miR-12-32603-3p binding encoding polyGlu. The ZFHX3 protein of human polyGlu contains 30 Glu. In the orthologous proteins of 36 animal species the length of polyGlu varied from 27 Glu to 33 Glu. Negatively charged polyGlu of the ZFHX3 transcription factor probably interacted with positive DNA-binding proteins. The following mRNA region of the ZFHX3 gene contained the binding sites for miR-17-39416-3p, miR-5-15733-3p, miR-9-20317-3 encoding polyAla by 15 Ala lengths. In the 33 ZFHX3 orthologous proteins polyAla had the same length. The mRNA region of the human ZFHX3 gene with binding polysite of miR-1322-3p encoded polyGln consisting of 19 Gln. In the 41 orthologs of the ZFHX3 protein the length of polyGln varied from seven Gln to 23 Gln. The binding sites of miR-2-6184-3p, miR-5-14114-5p and miR-19-43437-5p were located with overlapping nucleotides sequences, and encode polyPro. In ZFHX3 human polyPro consisted of 12 Pro. In the orthologs, polyPro contained from 10 Pro to 14 Pro. The binding sites of miR-17-39416-3p, miR-9-20317-3p, miR-1-1819-3p, miR-5-15733-3p, miR-6-17815-3p, miR-18-39953-5p, miR-26862-5p, miR-1260b and miR-X-48174-3p in human ZFHX3 encoded polyGly by 22 Gly length. In the 28 orthologs of ZFHX3 the length of polyGly decreased to 11 Gly. The TNR regions could simultaneously bind several miRNAs, which increased the dependence of gene expression on miRNA. The oligopeptides encoded by the binding polysites of miRNA in mRNA in the orthologous ZFHX3 proteins were flanked by conserved oligopeptides.

The binding of 2,578 human miRNAs with the mRNAs of 12,175 human genes was studied. It was established that miR-619-5p, miR-5095, miR-5096, and miR-5585-3p bind with high affinity to the mRNAs of the 1215, 832, 725, and 655 genes, respectively. These unique miRNAs have binding sites in the coding sequences and untranslated regions of mRNAs. The mRNAs of many genes have multiple miR-619-5p, miR-5095, miR-5096, and miR-5585-3p binding sites. Groups of mRNAs in which the ordering of the miR-619-5p, miR-5095, miR-5096, and miR-5585-3p binding sites differ were established. The possible functional and evolutional properties of unique miRNAs are discussed.

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a–j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.

The development of breast cancer (BC) subtypes is controlled by distinct sets of candidate genes, and the expression of these genes is regulated by the binding of their mRNAs with miRNAs. Predicting miRNA associations and target genes is thus essential when studying breast cancer. The MirTarget program identifies the initiation of miRNA binding to mRNA, the localization of miRNA binding sites in mRNA regions, and the free energy from the binding of all miRNA nucleotides with mRNA. Candidate gene mRNAs have clusters (miRNA binding sites with overlapping nucleotide sequences). mRNAs of EPOR, MAZ and NISCH candidate genes of the HER2 subtype have clusters, and there are four clusters in mRNAs of MAZ, BRCA2 and CDK6 genes. Candidate genes of the triple-negative subtype are targets for multiple miRNAs. There are 11 sites in CBL mRNA, five sites in MMP2 mRNA, and RAB5A mRNA contains two clusters in each of the three sites. In SFN mRNA, there are two clusters in three sites, and one cluster in 21 sites. Candidate genes of luminal A and B subtypes are targets for miRNAs: there are 21 sites in FOXA1 mRNA and 15 sites in HMGA2 mRNA. There are clusters of five sites in mRNAs of ITGB1 and SOX4 genes. Clusters of eight sites and 10 sites are identified in mRNAs of SMAD3 and TGFB1 genes, respectively. Organizing miRNA binding sites into clusters reduces the proportion of nucleotide binding sites in mRNAs. This overlapping of miRNA binding sites creates a competition among miRNAs for a binding site. From 6,272 miRNAs studied, only 29 miRNAs from miRBase and 88 novel miRNAs had binding sites in clusters of target gene mRNA in breast cancer. We propose using associations of miRNAs and their target genes as markers in breast cancer subtype diagnosis.