miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes

Abstract

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a–j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.

Human Genes AreIn SilicoPotential Targets For Rice miRNA

“…For all miR2102-5p, miR2919, and miR5075-3p binding sites, nucleotide conservation is present compared to the flanking nucleotides of mRNA target genes. With the complete complementarity of the nucleotides miRNA and mRNA (ΔG/ΔGm = 100%) of the target genes, absolute conservatism of the site along the entire binding site should be observed, as previously shown (Atambayeva et al, 2017; Bari, Orazova & Ivashchenko, 2013; Bari et al, 2014; Yurikova et al, 2019). When the ΔG/ΔGm value changes from 94% to 100% (Table 1), the basis for the interaction of the nucleotides miR2102-5p, miR2919 and miR5075-3p and mRNA are G-С pairs.…”

“…2). The conservatism of such bonds between miRNAs and their target genes was established by us for many associations of miRNAs and their target genes in animals and plants (Atambayeva et al, 2017; Bari, Orazova & Ivashchenko, 2013; Bari et al, 2014; Yurikova et al, 2019). These bonds have persisted over tens of millions of years of evolution and indicate the early emergence of the process of regulation by miRNA molecules of target gene expression in animals and plants.…”

“…One form of evidence for the reliability of miRNA interaction with mRNA is the establishment of a conservative nucleotide sequence of binding sites in mRNA of target genes (Atambayeva et al, 2017; Bari, Orazova & Ivashchenko, 2013; Bari et al, 2014; Yurikova et al, 2019). The results of the analysis of the similarity of the nucleotide sequences of the binding sites in mRNA of the target genes miR2102-5p, miR2919 and miR5075-3p are shown in Fig.…”

“…To determine which pl-miRs affect the mRNAs of human genes, we chose osa-miRNAs because rice has the most miRNAs in the plants, and rice is the most common source of human nutrition. Most plants contain well-known miRNAs, which serve as typical regulators of plant growth and development (Bari, Orazova & Ivashchenko, 2013; Bari et al, 2014, Nair et al, 2010).…”

Functional Aspects of GRAS Family Proteins

“…It has been shown that the miRNA171 and 170 target several GRAS proteins (Llave et al, 2002;Bari et al, 2013). It has been shown that the miRNA171 and 170 target several GRAS proteins (Llave et al, 2002;Bari et al, 2013).…”