A possible causative role for the recently discovered hepatitis C virus (HCV) in the development of hepatocellular carcinoma (HCC) was investigated by assay of sera from HCC patients in Japan for antibodies to a recombinant HCV antigen and to hepatitis B virus (HBV) antigens. Among the 253 HCC patients examined, 156 (61.7%) had no serum markers of either a previous or a current HBV infection (group I), 46 (18.2%) were negative for HBV surface antigen but positive for anti-HBV surface and/or anti-HBV core antibody, indicating the occurrence of a previous, transient HBV infection (group II), and 51 (20.2%) were chronically infected HBV carriers as evidenced by positivity for HBV surface antigen (group Ill). The prevalence of HCV antibody in group I (68.6%) and II (58.7%) patients was significantly higher than for group m1 (3.9%) or in 148 additional patients with other (non-HCC) cancers (10.1%) (P < 0.01). Thus, there appears to be a strong association between HCV infection and the development of HCC, particularly in patients for which HBV infection cannot be implicated as a causative factor. The data also suggest an additional mode of transmission for HCV other than blood transfusion, since a history of blood transfusion was shown in only about 30% of the HCV antibodypositive HCC patients in groups I and 11. A high prevalence of HCV antibody was also shown among patients with HCC whose disease was originally thought to be due to very high ethanol consumption.The development of specific serological tests for infection by hepatitis A virus (HAV) and hepatitis B virus (HBV) has revealed that a large proportion of hepatitis cases are not caused by either ofthese agents (1-3). The resultant diagnosis of exclusion, non-A, non-B hepatitis (NANBH), now accounts for 95% of all posttransfusion hepatitis and over one-third of sporadic, acute hepatitis cases in Japan. Although symptoms in the acute phase of this disease are generally less severe than with HAV or HBV infection, NANBH is much more likely to develop into a persistent, chronic state. Over 50% of posttransfusion NANBH cases become chronically infected versus less than 10% in the case of HBV infections; typically, no chronicity results from infection by HAV. It is also clearly established that chronic NANBH can develop into hepatic cirrhosis (4-6). Accumulated serological, pathological, epidemiological, and clinical evidence suggests a significant association ofthe HBV carrier state with hepatocellular carcinoma (HCC) (7,8). In Japan, however, less than one-third ofHCC patients are also chronic HBV carriers, and the number of surgically treated HCC cases with no serological markers of prior or current HBV infection has increased steadily in Japan during the last 10 years (9). This suggests another causative factor(s). It has been hypothesized that NANBH virus(es) might be the missing causative agent in HCC development (10)(11)(12)(13)(14).The etiological agent(s) of NANBH has long been sought by many research groups (15,16), and recently a NANBH agent, ter...

No abstract

Most cases of hepatitis C virus (HCV) infection result inHepatitis C virus (HCV) is the most important causative agent of blood-borne non-A non-B hepatitis, infecting a million people a year worldwide.

An enzyme-linked immunosorbent assay (ELISA) was developed for serological diagnosis of hepatitis C virus (HCV) infection, using HCV core protein (p22) synthesized by a recombinant baculovirus. Among 58 clinically well-defined chronic non-A, non-B hepatitis (NANBH) patients, 49 (84.5%) were positive for p22 antibody (anti-p22), whereas 42 (72.4%) were positive for

A structural protein of hepatitis C virus (HCV) was expressed in monkey COS cells under the control of an exogenous promoter, and a protein of 22 kDa was identified by immunoblot analysis. This protein (p22), which was produced by processing in COS cells, reacted specifically to sera of chronic hepatitis C patients, and its coding region was mapped at the most amino-terminal part of the HCV polyprotein. These results suggested that the p22 protein is the nucleocapsid (core) protein of HCV. Moreover, the assay detecting antibody to p22 was found to be useful for early diagnosis of HCV infection.

Hepatitis C virus (HCV) is the major causative agent of post transfusion non-A, non-B hepatitis throughout the world. We isolated and sequenced cDNA clones of the HCV genome from RNA extracted from healthy Japanese HCV carrier plasma samples by reverse polymerase chain reaction (rPCR) methods (1, 2). Primers were designed from the nucleotide sequence of HCV derived from an experimentally transmitted chimpanzee (3, 4). Here we report the complete nucleotide and amino acid sequences of the structural gene of HCV (Figure 1). Clones from three different but overlapping regions were isolated after rPCR. From each region, three clones were independently isolated and sequenced at both strands in order to deduce the consensus nucleotide sequence. We consider nucleotide (nt) 1 to ca. nt 570 as a coding gene for the nucleocapsid (core) protein because of (i) high nucleotide (90.5%) and amino acid (97.4%) sequence identity to those of the original HCV isolate (4), (ii) lack of Nglycosylation signal, (iii) existence of a highly hydrophobic domain particularly at its C-terminus, and (iv) detection of a 22-kilodalton protein expressed in mammalian cells by introducing this cDNA sequence under the control of a foreign promoter (5). The region from ca. nt 570 to ca. nt 1140 was considered to be the putative envelope gene. The deduced amino acid sequence was mostly hydrophobic and had 6 possible N--90 AGCCGAGAGTTGGGTCGCGAAAGGCCllGTGGFACTGCCTGATAGI'FC1GCAGTGCCCCGGGAGGTCTCGTAGACCGTGCATC -1 L L S C L T I P A S A T E V R N V S G I Y H V T N D C S N S 210glycosylation sites. The amino acid sequence homology to the equivalent region of the original isolate (4) was only 75.3%. The 5' non-coding region was also well conserved between the two isolates.ACKNOWLEDGEMENT

No abstract

The putative envelope protein of hepatitis C virus (HCV) was expressed in insect cells by using a baculovirus expression vector and in monkey COS cells under the control of exogenous promoters. The expressed envelope proteins, identified by immunoblot analysis using sera from patients with chronic HCV infection, were a series of glycoproteins of 35 to 24 kDa (gp35-24) in insect cells and a single species of glycoprotein of 35 kDa (gp35) in monkey cells. The size difference of these proteins was due to the different degrees of glycosylation. The envelope proteins expressed in these cells were produced by common specific cleavage from the precursor protein, and cleavage positions of the envelope protein were mapped at about amino acids 190 and 380. The gp35-24 proteins expressed in insect cells were used for detection of antibody against HCV envelope protein in patient sera. The results showed that (i) the antibody is detected in 2 to 17% of various patients with hepatitis C, (ii) three patients were apparently cured after acquiring the antienvelope antibody, and (iii) in sera of patients with more than a 20-year history of infection, the antibody sometimes coexisted with HCV. These results suggest that the antienvelope antibody is neutralizing only in limited number of patients with hepatitis C.