Nucleotide sequence of core and envelope genes of the hepatitis C virus genome derived directly from human healthy carriers

Abstract

Hepatitis C virus (HCV) is the major causative agent of post transfusion non-A, non-B hepatitis throughout the world. We isolated and sequenced cDNA clones of the HCV genome from RNA extracted from healthy Japanese HCV carrier plasma samples by reverse polymerase chain reaction (rPCR) methods (1, 2). Primers were designed from the nucleotide sequence of HCV derived from an experimentally transmitted chimpanzee (3, 4). Here we report the complete nucleotide and amino acid sequences of the structural gene of HCV (Figure 1). Clones from three different but overlapping regions were isolated after rPCR. From each region, three clones were independently isolated and sequenced at both strands in order to deduce the consensus nucleotide sequence. We consider nucleotide (nt) 1 to ca. nt 570 as a coding gene for the nucleocapsid (core) protein because of (i) high nucleotide (90.5%) and amino acid (97.4%) sequence identity to those of the original HCV isolate (4), (ii) lack of Nglycosylation signal, (iii) existence of a highly hydrophobic domain particularly at its C-terminus, and (iv) detection of a 22-kilodalton protein expressed in mammalian cells by introducing this cDNA sequence under the control of a foreign promoter (5). The region from ca. nt 570 to ca. nt 1140 was considered to be the putative envelope gene. The deduced amino acid sequence was mostly hydrophobic and had 6 possible N--90 AGCCGAGAGTTGGGTCGCGAAAGGCCllGTGGFACTGCCTGATAGI'FC1GCAGTGCCCCGGGAGGTCTCGTAGACCGTGCATC -1 L L S C L T I P A S A T E V R N V S G I Y H V T N D C S N S 210glycosylation sites. The amino acid sequence homology to the equivalent region of the original isolate (4) was only 75.3%. The 5' non-coding region was also well conserved between the two isolates.ACKNOWLEDGEMENT

Genetic organization and diversity of the hepatitis C virus.

“…Partial sequence data from the putative structural region of various HCV isolates has been reported recently (25,28). Fig.…”

“…1) is compared with that from three Japanese isolates. HC-J1 was derived from a blood donor (28), HC-J4 was from an isolate passaged in chimpanzees (28), and JH-1 was from a healthy human carrier (25). Amino acids identical with HCV-1 are indicated by horizontal lines and the numbering is according to that in Fig.…”

Comparison of Hepatitis C Virus Strains Obtained From Hemodialysis Patients

“…HCV has a positivestranded RNA as its genome. Nucleotide sequence analyses of HCV clones isolated in different places in the world revealed that there are significant sequence diversities (8)(9)(10)(11)(12)(13)(14)(15). The analysis of the region of non-structure 5 (NS5) of the HCV genome found, at least five different HCV genotypes in the world (16).…”

Typing of hepatitis C virus genomes by restriction fragment length polymorphism

“…The genome encodes two putative structural proteins which are translated from sequences in the vicinity of the 5' terminus of the genome: nucleocapsid protein, containing a number of basic amino acids, and envelope protein, containing nine potential glycosylation sites. Nonstructural proteins NS1 to NS5 are translated from the coding region immediately following the envelope gene (Okamoto et al, 1990 a;Kato et al, 1990;Takeuchi et al, 1990a;Takamizawa et al, 1991).…”