This experiment was carried out to study the photosynthate allocation between flush and young pods, and the effect of (naphthalene acetic acid) and (gibberellic acid) application to sink strength. Two cocoa clones KW 163 and KW 165 located in Kaliwining Experimental Station of Indonesian Coffea and Cocoa Research Institut were used on this experiment. Each clone was treated with flushes and without flush. Beside that, the young pods sprayed with NAA 250 mg L-1, GA 250 mg L-1, NAA 250 mg L-1 dan GA 250 mg L-1 and control (K = without NAA and GA). There were 2 x 4 treatment combinations for each clone, and replicated three trees for each combination. The parameter were cherelle wilt percentage, sucrose content, fresh and dry weight, long and diameter of healthy and wilting pods.The result showed that sink strength of young pods was lower than that of flushes, which caused application photosynthate translocation to the young pods was lower. NAA and GA application to the pods could improve sucrose allocation, increased pod weight and cherelle wilt was suppressed. The lack of photosynthate on young pod cause metabolism change, so pod became cherelle wilt. But, there was still not known the optimum concentration and method of application of those growth regulators to obtained minimum cherelle wilt.Key words: Cocoa, flush, pod, naphthylacatic acid, gibberellic acid, cherelle wilt.
Anatomical characteristics regenerant plantlet of Arabica coffee (Coffea arabica L.) were observed to determine the difference of plantlet performance between Sigararutang and Maragogige grown in shooting and rooting medium. Transverse sections of the fresh roots, stems and leaves of three-month-old plantlets from somatic embryos were collected and used for the study. Sigararutang and Maragogipe as the plantlet materials were chosen based on the bean size and the origin. Stomata were microscopically observed on the abaxial leaf paradermal section. A conformity test to compare between plantlet and the parent plant was observed to perform genetic stability. Assessment of genetic stability was measured by using the sequence of trnL (UAA) region. The result showed that all the anatomical roots, stems and leaves of the Maragogipe plantlet have a greater number than Sigararutang (root diameter, cortex thickness, distance of long stele, distance of short stele, endodermis thickness, stem diameter, cortex thickness, maximum stele diameter, minimum stele diameter, epidermis thickness, diameter of stomatal closing, length of stomatal closing, total stomatal density, adaxial epidermis density, midrib thickness, adaxial epidermis thickness, abaxial epidermis thickness, diameter of the vascular bundles, lamina thickness), except of epidermis thickness, diameter of the vascular bundles, diameter of stomatal aperture, diameter of stomatal opening, length of stomatal opening and abaxial epidermis density. Taxonomists may be able to use these anatomic traits as supplementary proof in the determination of Arabica coffee. Molecular analysis showed that there were genetically identical organisms between the plantlet and the parent plant. It was indicated there was no somaclonal variation during somatic embryogenesis in the micropropagation of Arabica coffee.
Coffea arabica L. is a species of coffee that contribute for more than seventy percent of world coffee production. Various attempts have been made to obtain large quantities of planting material through propagation in vitro somatic embryogenesis technology. The objective of this experiment was to evaluate the effect of different plant growth regulators (PGRs) on callus induction (indirect somatic embryogenesis) in AS2K clone of Arabica coffee. Mother plants of Arabica coffee were established in coffee experimental field of Indonesian Coffee and Cocoa Research Institute at Andung Sari, Bondowoso, East Java, Indonesia (-7˚55'' ' S, 113˚41'' ' E) at an altitude of 1380,1 m dpl. Leaf explants were cultured on a half-strength Murashige and Skoog (MS) medium supplemented with various concentration (1.0, 2.0, 3.0 mg/L) of 2,4-D and (1.0, 2.0, 3.0 mg/L) thidiazuron in combination with 1.0 mg/L BAP. All the experiments were organized in completely random design (CDR) and repeated three times, each using minimum seven replicates (a total of 21 explants per treatment). The morphologycal and histological analysis of the different types of callus were observed. The percentage of callus formation was recorded every two weeks until eight weeks. The highest percentage of callus formation (almost 60%) was in medium containing 1 mg/L 2,4-D dan 1 mg/L BAP. Morphological and histological studies prove that the callus has a friable and embryogenic texture and begins to develop various stages of somatic embryo formation, starting with the globular, heart, torpedo and cotyledonary phases.
This study aims to evaluate the dinamics of coffee production in Mandang, Sucen Village, Gemawang District, Temanggung on 2018 and 2019. The research was carried out at people coffee plantation in Mandang Hamlet, Sucen Village, Temanggung. Research using survey methods. Observation of performance with 30 samples taken by purposive sampling technique on 3 clones. Land suitability analysis was carried out at 3 observation points. The results obtained are: The vegetative characteristics of robusta coffee BP 288 and BP 409 are better than BP 358 clones, while the robusta coffee production is the same on various clones and plantation location. The long dry season in 2018 and 2019 has an effect on the decline of the number of leaves and coffee production in 2019 compared to 2018 in Mandang Hamlet, Sucen Village, Gemawang district, Temanggung.
This research aims to study the condition of the land, its relation to the character of the coffee plant in the farmers’ coffee plantation in the Sucen Village, Gemawang District, Temanggung, Indonesia. The research was carried out at a community coffee plantation in Sucen Village, Temanggung, Central Java, Indonesia. The research was conducted using descriptive and inferential statistics. Observation of performance with 30 samples was conducted by random sampling technique in three clones. Land suitability analysis was carried out at three observation points. The result showed that the vegetative character of BP 409 clones is better than BP 288 and BP 358. However, the highest production was obtained at BP 288. Land suitability in Sucen Village remains in the inappropriate criteria, which can be improved through land conservation and balanced fertilization.
The effects of LEDs (Light-Emitting Diodes) emitting different colours namely red, blue, red and blue, and white lights on vegetative growth and fl ower initiation of Phalaenopsis have been evaluated. Phalaenopsis"otohine/taisuco fi re bird" seedlings in vitro were subjected to different light qualities for either 2 or 4 weeks, and then each seedling was planted in a plastic pot containing sphagnum and grown in the growth chamber under similar light quality for 3 months. For fl ower induction, mature Phalaenopsis plants having 4 -6 leaves were grown for 3 months in the growth chamber under different light qualities. The leaf span, chlorophyll, gibberellin and cytokinin content were determined. In addition, the expressions of FT-like gene in the leaf, axillary bud, fl ower bud and stalk were examined.Vegetative growth was enhanced under blue, red-blue or white LEDs compared to that of the control. Gibberellin and cytokinin content increased in the seedlings subjected to white LEDs. Based on the average of leaf span increment it was suggested that the growth of Phalaenopsis seedlings can be promoted by giving either blue, red-blue or white LEDs. From the second experiment, it was found that fl ower induction in Phalaenopsis can be obtained in plants that had just fi nished fl owering without the application of LEDs. The expression of FT-like gene in the leaf as well as fl ower bud and stalk suggests that this gene is involved in fl ower regulation of Phalaenopsis.
Sugarcane problems in germination will effect on growth and the yield that is not optimal. The solution obtained from these problems is plant growth regulators soaking and storage time bud sett seedling before planting. This study used a factorial experimental method with the first factor being storage time consisting of 3 levels, namely 0 days (control), 1 day, and 2 days. The second factor was PGR soaking which consisted of control (without PGR soaking), NAA + IBA, and IAA . The experiment was carried out in a completely randomized design with 3 replications. The results of the observations were analyzed by means of variance at the 5% level and the DMRT test to determine the differences between treatments. The combination of storage time and soaking PGR treatments affected the germination of sugarcane seedlings. Control treatment, NAA+IBA , IAA soaking and 1-day storage,germinated faster than the same treatment and stored for 2 days, even seedling soaked in PGR did not germinate. The NAA+IBA, IAA soaking treatment and 1 day storage had better growth than the same treatment, without storage and 2 days storage.The length of storage and soaking of several PGRs before planting gave the same effect on the age of shoots and the number of shoots. Key words : Sugarcane bud sett, plant growth regulators soaking, storage time, IAA,IBA, NAA
This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.