Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) R. Li et al. Genome Announc. 1(5):e00794-13, 2013. (3) Y. Xie et al. Virol. J. 10:142, 2013.
Panax notoginseng, an important medicinal herb commonly known as notoginseng, san qi, or tian qi, is in the family Araliaceae. The herb is mainly cultivated in Guangxi and Yunnan provinces of southern China for its root, which is used in Chinese herbal medicine to treat various blood disorders. In December 2012, Panax yellowing was observed in several notoginseng farms with prevalence of 5 to 10% in Wenshan, Yunnan Province. Foliar symptoms included yellowing, shrinking, curling, and blistering. Leaf samples collected from 15 symptomatic plants were initially tested by negative staining electron microscopy, and no distinct virions were observed. Total nucleic acids were extracted from these samples by a CTAB method and used as templates in RT-PCR for presence of criniviruses, tobamoviruses, and tospoviruses, but results were negative. Infestation of whiteflies (Bemisia tabaci) has been a problem on these farms in recent years, suggesting a whitefly-transmitted begomovirus as potential causal agent. To explore this possibility, the samples were tested by PCR using degenerate primers BegoAFor1 and BegoARev1 described by Ha et al. (3). Amplicons of ~1.2 kbp were obtained from 12 out of 15 samples, indicating the presence of a putative begomovirus. These amplicons were cloned and sequenced in both directions. BLAST search showed that they had high sequence identities (94 to 95%) to the genome of Tomato yellow leaf curl China virus (TYLCCNV). A pair of virus-specific primers, TYLCCNVFa (5′-TGRTAGGWACYTGAGTAGAGTGG-3′) and TYLCCNVRa (5′-TCRTCCATCCATATCTTCCCAA-3′), was then designed and used to amplify the remaining genomic sequence. The full-length genomic sequence of one isolate, YWSh03, was determined to be 2,733 nt (KJ477327). Sequence comparison showed that the genome of YWSh03 shared 96.2% nucleotide sequence identity with that of TYLCCNV-[G102] (AM050555). PCR using primers Beta01 and Beta02 (1) was also tested for the association of betasatellite with this virus. A DNA fragment was obtained from isolate YWSh03, and its sequence was determined to be 1,336 bp (KJ477326). This sequence has 99.9% nucleotide sequence identity to Tomato yellow leaf curl China betasatellite (TYLCCNB) [Y10] (AJ421621). The results show that TYLCCNV, a virus infecting tomato, tobacco, kidney bean, and several weeds (2), is also associated with the yellowing disease in P. notoginseng. To determine whether TYLCCNV and TYLCCNB might cause disease on P. notoginseng, infectious clones of TYLCCNV and TYLCCNB provided by Dr. Xueping Zhou (Zhejiang University, China) were used to inoculate to 44 healthy P. notoginseng plants by an Agrobacterium-mediated method. Thirty-four inoculated plants showed typical symptoms of yellowing, curling, and stunting, confirming TYLCCNV and TYLCCNB are the causal agents of the disease. To further investigate the distribution and incidence of the virus, 258 symptomatic P. notoginseng samples were collected from 18 fields in Wenshan, Honghe, Qujing, and Kunming of Yunnan Province and tested by PCR with TYLCCNV-specific primers of TYLCCNVdF (5′-CCTGTATATGCGACTTTGAAAGT-3′) and TYLCCNVdR (5′-CCCAATTCCAGCTATAAAGAGTA-3′). The virus was detected in 149 samples (57.8%), indicating that TYLCCNV infection of P. notoginseng is common. However, the agent causing the disease in the 109 symptomatic plants lacking TYLCCNV remains under investigation. To our knowledge, this is the first report of TYLCCNV with TYLCCNB infecting P. notoginseng and the family Araliaceae. References: (1) R. W. Briddon et al. Mol Biotechnol. 20:315, 2002. (2) J. H. Dong et al. Plant Pathol. 56:342, 2007. (3) C. Ha et al. J. Gen. Virol. 87:997, 2006.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.