No abstract

The refined solution structure for the 8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 adduct was refined from the oligodeoxynucleotide duplex d(TATAFBGCATA)2 using a molecular dynamics protocol restrained by NOE data obtained from 1H NMR and compared with the refined structure of the unmodified oligomer, d(TATGCATA)2. The two aflatoxin B1 (AFB1) moieties were symmetry related by the pseudodyad axis of the self-complementary oligodeoxynucleotide. Each AFB1 intercalated into the helix above the 5'-face of the modified guanine, corroborating NMR spectroscopic data [Gopalakrishnan, S., Harris, T. M., and Stone, M. P. (1990) Intercalation of Aflatoxin B1 in Two Oligodeoxynucleotide Adducts: Comparative 1H NMR Analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2 Biochemistry 29, 10438-10448]. Molecular dynamics calculations restrained with 292 experimentally and empirically derived distances refined a family of structures characterized by pairwise root mean square differences of <1.3 A. Complete relaxation matrix calculations yielded a sixth root residual of 11 x 10(-2). Comparison of the refined structure with that of the corresponding unmodified oligodeoxynucleotide suggested that the two AFB1 adducts introduced a perturbation of the DNA localized at the two sites of adduction. The calculations predicted that each adduct introduced a "kink" into the DNA helical axis. However, the pseudodyad symmetry relating the two intercalation sites resulted in no net bending of the DNA. The results suggest the possibility that AFB1 lesions at adjacent guanines in the 5'-GC-3' sequence may be recognized or processed differently than are isolated AFB1 lesions.

Topoisomerase II is the target for several anticancer drugs that "poison" the enzyme and convert it to a cellular toxin by increasing topoisomerase II-mediated DNA cleavage. In addition to these "exogenous topoisomerase II poisons," DNA lesions such as abasic sites act as "endogenous poisons" of the enzyme. Drugs and lesions are believed to stimulate DNA scission by altering the structure of the double helix within the cleavage site of the enzyme. However, the structural alterations that enhance cleavage are unknown. Since abasic sites are an intrinsic part of the genetic material, they represent an attractive model to assess DNA distortions that lead to altered topoisomerase II function. Therefore, the structure of a double-stranded dodecamer containing a tetrahydrofuran apurinic lesion at the +2 position of a topoisomerase II DNA cleavage site was determined by NMR spectroscopy. Three major features distinguished the apurinic structure ( = 0.095) from that of wild-type ( = 0.077). First, loss of base stacking at the lesion collapsed the major groove and reduced the distance between the two scissile phosphodiester bonds. Second, the apurinic lesion induced a bend that was centered about the topoisomerase II cleavage site. Third, the base immediately opposite the lesion was extrahelical and relocated to the minor groove. All of these structural alterations have the potential to influence interactions between topoisomerase II and its DNA substrate.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

No abstract

This work describes the preparation of the cationic trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) ((AFB)G) adducts at the positions corresponding to G(746) or G(747), within the oligodeoxyribonucleotide d(GGAGGCCT) containing the codon 249 sequence (underlined) of the p53 gene, using DNA triplexes to target adduction at the desired site. This approach enabled the successful preparation and purification of sufficient quantities of d(GGAG(AFB)GCCT) for NMR structural studies, using only standard phosphoramidites. The presence of multiple guanines in this oligodeoxynucleotide precluded the direct reaction of d(GGAGGCCT). d(AGGCCTCC) with aflatoxin epoxide as a method for producing large quantities of site-specific adducts for physical studies. Of the multiple potential alkylation sites at guanine N7 in d(GGAGGCCT). d(AGGCCTCC), it was found that sites G(2) and G(5) exhibited approximately equal reactivity with aflatoxin B(1)-exo-8,9-epoxide; the reactivity at site G(4) was reduced by approximately a factor of 2 as compared to that at G(2) or G(5). To successfully prepare the site-specific adducts, the p53 oligodeoxyribonucleotide was annealed with either the blocking strand d(CTCCATTTTCCT) or d(CCTCCATTTTCCTC) to form the corresponding partial triplexes which targeted AFB(1) adduction either to G(4) or to G(5). Piperidine cleavage, followed by heating, confirmed that in each instance, the product corresponded to the lone guanine not protected from adduction by the partial DNA triplex. The adducted oligodeoxyribonucleotides were examined with regard to purity by capillary electrophoresis. The primary advantage of this modified triple helix methodology is that it requires only standard phosphoramidites; thus, it is applicable to large-scale preparations that are necessary for NMR structural studies or other physical measurements.

No abstract