Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides

Abstract

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Natural product DNA major groove binders

“…26 Studies suggest that triplex formation in the major groove, specifically a CGC + base triplet, either preclude suitable intercalation site for the aflatoxin B 1 or hinder the necessary geometry for reaction; therefore preventing adduct formation at the guanine N7 positions due to poor accessibility. 27 It is also possible that since the formation of triplex involves hydrogen bonding to N7, it renders this position nonnucleophilic.…”

Unique Aggregation of Sterigmatocystin in Water Yields Strong and Specific Circular Dichroism Response Allowing Highly Sensitive and Selective Monitoring of Bio-Relevant Interactions

“…On Nile tilapia fish, the clastogenic effect of STC was indicated by the significant decrease of body weight and the increase in frequencies of micronucleated red blood cells and chromosomal aberrations in the kidney [30]. The complex toxicity-related metabolism consists of many transformations and interactions with various targets, including DNA non-covalent and covalent binding [31,32,33,34,35,36,37], enzyme-controlled epoxidation [38,39], and some others [40,41,42,43,44,45], of which many take place at water interface. These properties along with currently used analytical methods for AFB 1 and STC determination (which include complicated procedures and application of organic solvent extractions [29,46]) prompted us to investigate the aqueous solubility properties of both mycotoxins (Scheme 1) and their water/lipophilic solvent distribution.…”

Site-Specific Synthesis of Aflatoxin B1 Adducts within an Oligodeoxyribonucleotide Containing the Human p53 Codon 249 Sequence

“…The observation that the third strand of a DNA triplex could target site-specific cleavage of DNA (41)(42)(43)(44) suggested an alternative route to large-scale sitespecific incorporation of AFB 1 in the p53 gene. This was demonstrated by the ability of nicked DNA triplexes to site-specifically direct AFB 1 adduction within an iterated repeat of five guanines (45). In that instance, the third strand of DNA in the major groove blocked reactivity at the N7 positions of guanines involved in triplex formation, allowing adduction to be targeted in a site-specific manner to nonprotected guanines.…”

“…The selectivity of the nicked triplex approach was dependent upon equilibrium binding between the triplex-forming blocking strand and the targeted duplex. This was not a problem in the smallscale syntheses used in the previous study (45). However, there were concerns about whether this approach could be successfully scaled to produce larger quantities of sitespecific adducts required for NMR analysis.…”