No abstract

In Argentina, more than 60 % of the tobacco crops are grown in the northwestern part of the country and where Rhizoctonia solani leads to a reduction in crop yield and quality. In this study, 35 isolates of Rhizoctonia were obtained from 32 tobacco fields in northwestern Argentina and characterized by both morphological and molecular approaches. Based on the variability in the ITS region, isolates were identified as R. solani (80 %), Waitea circinata var. zeae (Rhizoctonia zeae) (8 %) and binucleate Rhizoctonia (8 %). Most isolates of R. solani belonged to the anastomosis groups (AGs) AG 4 HG-I (44 %), AG 2-1 (41 %) and AG 4 HG-III (13 %). Isolates of binucleate Rhizoctonia belonged to AG-F and AG-P of Ceratobasidium sp. Morphological variability was higher within isolates of AG 2-1 and AG 4 HG-III than within those of AG 4 HG-I. Aggressiveness of the isolates towards tobacco seedlings was assessed in the greenhouse.Isolates of AG 2-1 were the most aggressive on leaves, causing target spot, whereas isolates of AG 4 HG-I were the most aggressive on stems and roots, causing damping-off.

In order to determine the behavior of mycotoxin-producing fungal populations linked with silobags stored corn grains with a moisture content greater at the recommended as safe, 270 samples taken in three times (beginning, 90 days, final) over a five month period of storage were evaluated. The fungal biota was quantified and identified and the contamination with fumonisin and aflatoxin was determined. Extrinsic factors (environment), intrinsic factors (grains) and technological factors (location of the grains in the profile of silobag) were taken into account to evaluate the presence and quantity of total and mycotoxigenic fungal populations. The pH of grains and O2 levels were significantly reduced after five months, while CO2 concentration increased in the same period. The total counts of mycobiota were significantly higher in grains located in the top layer of silobag. Mycotoxigenic species of Fusarium, Aspergillus, Penicillium and Eurotium were identified. The frequency of isolation of Fusarium verticillioides decreased at the end of storage and Aspergillus flavus was isolated only at the beginning of storage. The counts of the Penicillium spp. and Eurotium spp. were increased at the end of storage. Fumonisin contamination was found in all the samples (100%) with maximum levels of 5.707mg/kg whereas aflatoxin contaminated only 40% with maximum levels of 0.0008mg/kg. The environmental and substrate conditions generated during the storage limited the development of mycotoxigenic fungi and mycotoxin production.

No abstract

No abstract

The genus Cladorrhinum constitutes a fungal group of prime importance for agriculture and livestock, since some species have biocontrol potential or were shown to promote plant growth and to produce phytases, which are enzymes useful for processing animal feed. We assessed the species diversity of Cladorrhinum in Argentina. Strains were identified at the species level by analysis of morphological and physiological characters, as well as by using molecular characters and by sequencing three nuclear DNA loci: internal transcribed spacer regions (ITS), and the 28S ribosomal subunit and β-tubulin genes. C. bulbillosum and C. samala were detected, and a new species is described as C. australe.

No abstract

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.