Mice with deficiency in tocopherol (alpha) transfer protein gene develop peripheral tocopherol deficiency and sensory neurodegeneration. Ttpa mice maintained on diets with deficient α-tocopherol (α-TOH) had proprioceptive deficits by six months of age, axonal degeneration and neuronal chromatolysis within the dorsal column of the spinal cord and its projections into the medulla. Transmission electron microscopy revealed degeneration of dorsal column axons. We addressed the potential pathomechanism of α-TOH deficient neurodegeneration by global transcriptome sequencing within the spinal cord and cerebellum. RNA-sequencing of the spinal cord in Ttpa mice revealed upregulation of genes associated with the innate immune response, indicating a molecular signature of microglial activation as a result of tocopherol deficiency. For the first time, low level Ttpa expression was identified in the murine spinal cord. Further, the transcription factor liver X receptor (LXR) was strongly activated by α-TOH deficiency, triggering dysregulation of cholesterol biosynthesis. The aberrant activation of transcription factor LXR suppressed the normal induction of the transcription factor retinoic-related orphan receptor-α (RORA), which is required for neural homeostasis. Thus we find that α-TOH deficiency induces LXR, which may lead to a molecular signature of microglial activation and contribute to sensory neurodegeneration.

Background Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin E consists of 8 isoforms metabolized by the CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM. Hypothesis/Objectives Based on the association of α‐tocopherol deficiency with the development of eNAD/EDM, we hypothesized that the rate of α‐tocopherol, but not γ‐tocopherol or tocotrienol metabolism, would be increased in eNAD/EDM‐affected horses. Animals Vitamin E metabolism: Proof of concept (POC) study; eNAD/EDM‐affected (n = 5) and control (n = 6) horses. Validation study: eNAD/EDM‐affected Quarter Horses (QHs; n = 6), cervical vertebral compressive myelopathy affected (n = 6) horses and control (n = 29) horses. CYP4F2 expression and copy number: eNAD/EDM‐affected (n = 12) and age‐ and sex‐matched control (n = 11‐12) horses. Methods The rates of α‐tocopherol/tocotrienol and γ‐tocopherol/tocotrienol metabolism were assessed in equine serum (POC and validation) and urine (POC only) using liquid chromatography tandem mass spectrometry (LC‐MS/MS). Quantitative reverse‐transcriptase PCR (qRT‐PCR) and droplet digital (dd)‐PCR were used to assay expression and genomic copy number of a CYP4F2 equine ortholog. Results Metabolic rate of α‐tocopherol was increased in eNAD/EDM horses (POC,P < .0001; validation, P = .03), with no difference in the metabolic rate of γ‐tocopherol. Horses with eNAD/EDM had increased expression of the CYP4F2 equine orthologue (P = .02) but no differences in copy number. Conclusions and Clinical Importance Increased α‐tocopherol metabolism in eNAD/EDM‐affected QHs provides novel insight into alterations in vitamin E processing in eNAD/EDM and highlights the need for high‐dose supplementation to prevent the clinical phenotype in genetically susceptible horses.

Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9-54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (P allelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.

No abstract

We sought to establish a large animal model of inherited hypertrophic cardiomyopathy (HCM) with sufficient disease severity and early penetrance for identification of novel therapeutic strategies. HCM is the most common inherited cardiac disorder affecting 1 in 250–500 people, yet few therapies for its treatment or prevention are available. A research colony of purpose-bred cats carrying the A31P mutation in MYBPC3 was founded using sperm from a single heterozygous male cat. Cardiac function in four generations was assessed by periodic echocardiography and measurement of blood biomarkers. Results showed that HCM penetrance was age-dependent, and that penetrance occurred earlier and was more severe in successive generations, especially in homozygotes. Homozygosity was also associated with progression from preclinical to clinical disease. A31P homozygous cats represent a heritable model of HCM with early disease penetrance and a severe phenotype necessary for interventional studies aimed at altering disease progression. The occurrence of a more severe phenotype in later generations of cats, and the occasional occurrence of HCM in wildtype cats suggests the presence of at least one gene modifier or a second causal variant in this research colony that exacerbates the HCM phenotype when inherited in combination with the A31P mutation.

Guinea pigs were maintained for various periods of time on low (0.5 mg/day), intermediate (20 mg/day), or high (100 and 500 mg/day) levels of dietary ascorbic acid. Animals in each experimental group were challenged with Candida albicans via cardiac injection, and the course of infection in the kidneys was assessed. The results show that the animals receiving only 0.5 mg of ascorbic acid per day were significantly more susceptible to the infection than animals maintained on any higher level of dietary ascorbic acid. The greater susceptibility of the guinea pigs in the 0.5-mg level group was evident, however, only during "early" stages of the infection (until about day 3). Guinea pigs receiving high levels of dietary ascorbic acid were no more resistant at any time after infection, or with any challenge dose, than those receiving an intermediate dietary level. Although these data suggest that vitamin C may be involved in resistance to candidiasis, tissue levels of ascorbic acid do not change significantly with time after infection. These results indicate that low levels of dietary ascorbic acid increase susceptibility to candidiasis, yet high (or "megadose") levels of dietary vitamin C do not show any effect on resistance to this microorganism.

Small molecule inhibitors are an emerging class of novel therapeutic agents that inhibit the function of specific proteins with the potential for neutralizing deleterious downstream effects (Bond et al., 2013). One class of these compounds include cardiac myosin inhibitors, which are being investigated for their potential therapeutic uses in a vast array of disease processes including hypertrophic cardiomyopathy (HCM) (Alsulami & Marston, 2020;Argirò et al., 2021).

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.