In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

A rapid and simple RT-PCR diagnosis method for detection of Rice stripe virus (RSV), one of major virus infecting rice, was developed using porous ceramic cubes in this study. The porous ceramic cube can rapidly absorb biological molecules such as small-sized proteins and nucleic acid fragments into its pores. We examined whether this ability of porous ceramic cubes could be applied for isolating viral nucleic acids or particles from the RSV-infected plant tissues. In this study, we found that the porous ceramic cube was capable of absorbing a detection level of viruses from the rice tissues infected with RSV and established RT-PCR-based RNA diagnosis method using porous ceramic cubes.

No abstract

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar ‘Nyoho’ in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Cowpea (Vigna unguiculata L. Walp) is one of the important legume crops of Nepal, which is consumed as a green vegetable or a dried pulse. In recent years, virus diseases have caused significant yield and quality losses in cowpea. In September 2019, five cowpea plants showing virus-like symptoms of mosaic, yellow mosaic, vein clearing, chlorotic spots, (Fig. S1) were collected in Chitwan, Nepal. The incidence of symptomatic plants in the three kitchen gardens was about 10-20%. To identify the viruses associated with the disease, a pooled sample from all five plants was screened initially by next generation sequencing (NGS). Total RNA was extracted from the symptomatic leaves using RNeasy Plant Mini Kit (Qiagen, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep kit (Illumina, San Diego, CA) according to the standard protocol. NGS was performed using an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). A total of 324,807 contigs in the range of 201-14,645 nucleotides (nt) were obtained and analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx search. Among the analyzed contigs, two large contigs showed homologies to cowpea polerovirus 2 (CPPV2) and southern cowpea mosaic virus (SCPMV. The CPPV2 contig (361,121 mapped reads, mean read coverage of 9,206.4 times) had a nearly complete genome sequence of 5,923 nt and showed 96% identity (99% coverage) with CPPV2 isolate BE179 (GenBank Acc. No. KY364847) isolaed from cowpea in Burkina Faso (Palanga et al. 2017). The SCPMV contig (10,612 mapped reads, mean read coverage of 384.1 times) had a nearly complete genome sequence of 4,172 nt and showed 90% identity (100% coverage) with SCPMV isolate C (GenBank Acc. No. M23021) isolated from cowpea in the USA (Wu et al. 1987). Additionally, mungbean yellow mosaic India virus (MYMIV, genus Begomovirus) and bean common mosaic virus (BCMV, genus Potyvirus) were detected at very low read depths. To confirm the presence of these viruses, total RNA was extracted from individual leaf samples, and reverse transcription PCR (RT-PCR) was performed using specific primers for each virus (Table S1). Three of five cowpea samples were positive for CPPV2, and they were co-infected with one other virus; SCPMV, MYMIV, or BCMV (Fig. S1). One cowpea sample was positive for the remaining one with symptom of overall chlorosis was negative for all four viruses. The amplified products of 1,205 bp for CPPV2 isolates, CPPV2-NP10, -NP12, and -NP24 were sequenced and deposited in GenBank under accession nos. MZ318692-93. These Sanger sequences shared 99% nt identity with the NGS-derived sequence. The amplified product of 1,394 bp for SCPMV isolate SCPMV-NP12 (GenBank acc. no. MZ355623) shared 100% nt identity with the NGS-derived sequence. CPPV2 is a member of the genus Polerovirus and it was first identified and characterized by molecular assays in Burkina Faso (Palanga et al. 2016; 2017). SCPMV is a member of the genus Sobemovirus and it has been reported in the USA, China, and Burkina Faso (Hull et al. 2000; Lee et al. 2001; Wu et al. 1987). In Nepal, MYMIV has been reported in legumes, such as kidney bean, black gram, and mungbean, and BCMV in common bean (Acharya and Regmi 2020). To our knowledge, this is the first report of CPPV2 and SCPMV in cowpea in Nepal. Further work is required to determine the distribution, pathological properties, and economic impact of these two viruses.