DNA methyltransferase 3B (Dnmt3b) belongs to a family of enzymes responsible for methylation of cytosine residues in mammals. DNA methylation contributes to the epigenetic control of gene transcription and is deregulated in virtually all human tumors. To better understand the generation of cancer-specific methylation patterns, we genetically inactivated Dnmt3b in a mouse model of MYC-induced lymphomagenesis. Ablation of Dnmt3b function using a conditional knockout in T cells accelerated lymphomagenesis by increasing cellular proliferation, which suggests that Dnmt3b functions as a tumor suppressor. Global methylation profiling revealed numerous gene promoters as potential targets of Dnmt3b activity, the majority of which were demethylated in Dnmt3b -/-lymphomas, but not in Dnmt3b -/-pretumor thymocytes, implicating Dnmt3b in maintenance of cytosine methylation in cancer. Functional analysis identified the gene Gm128 (which we termed herein methylated in normal thymocytes [Ment]) as a target of Dnmt3b activity. We found that Ment was gradually demethylated and overexpressed during tumor progression in Dnmt3b -/-lymphomas. Similarly, MENT was overexpressed in 67% of human lymphomas, and its transcription inversely correlated with methylation and levels of DNMT3B. Importantly, knockdown of Ment inhibited growth of mouse and human cells, whereas overexpression of Ment provided Dnmt3b +/+ cells with a proliferative advantage. Our findings identify Ment as an enhancer of lymphomagenesis that contributes to the tumor suppressor function of Dnmt3b and suggest it could be a potential target for anticancer therapies.
g DNA cytosine methylation is an epigenetic modification involved in the transcriptional repression of genes controlling a variety of physiological processes, including hematopoiesis. DNA methyltransferase 1 (Dnmt1) is a key enzyme involved in the somatic inheritance of DNA methylation and thus plays a critical role in epigenomic stability. Aberrant methylation contributes to the pathogenesis of human cancer and of hematologic malignancies in particular. To gain deeper insight into the function of Dnmt1 in lymphoid malignancies, we genetically inactivated Dnmt1 in a mouse model of MYC-induced T-cell lymphomagenesis. We show that loss of Dnmt1 delays lymphomagenesis by suppressing normal hematopoiesis and impairing tumor cell proliferation. Acute inactivation of Dnmt1 in primary lymphoma cells rapidly induced apoptosis, indicating that Dnmt1 is required to sustain T-cell lymphomas. Using high-resolution genome-wide profiling, we identified differentially methylated regions between control and Dnmt1-deficient lymphomas, demonstrating a locus-specific function for Dnmt1 in both maintenance and de novo promoter methylation. Dnmt1 activity is independent of the presence of Dnmt3a or Dnmt3b in de novo promoter methylation of the H2-Ab1 gene. Collectively, these data show for the first time that Dnmt1 is critical for the prevention and maintenance of T-cell lymphomas and contributes to aberrant methylation by both de novo and maintenance methylation.
The diversity of ZYMV isolates was analysed by the biological and molecular characterisation of 11 isolates sampled from cucumber, squash and zucchini between 2001 and 2006 in various localities of Slovakia and Czech Republic. Analysis of the molecular variability targeting three separate genomic regions of the ZYMV genome [P1, P3 and (Cter)NIb-(Nter)CP] revealed a remarkable low level of nucleotide variability between isolates, despite their temporal and spatial distinction. Phylogenetic analysis based on the 5'-terminal part of the CP gene highlighted the close relatedness of Slovak, Czech and other central European isolates. Low level of genetic diversity within central European ZYMV isolates is in contrast to the diversity observed for isolates from other geographical regions, in particular Asia. No evidence of recombination in the ZYMV genome was detected. Sequence comparison between aggressive and moderate ZYMV isolates revealed one amino acid difference in the N-terminal part of the P3 protein, potentially involved in the tolerance breaking.
The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.
Plum pox virus (PPV) isolates differ by their capsid protein (CP) mobility in SDS-PAGE. These electrophoretic phenotypes are likely to result from post-translational modifications of the CP. We demonstrated that the CP mobility was solely determined by the CP N-terminal region. Sequence comparison pinpointed a possible role of mutations at position 66 in determining the CP phenotype of PPV-Rec isolates. Site-directed mutagenesis of a chimeric clone demonstrated that Gly(66) in the CP resulted in the double-band phenotype, while Arg(66) led to a single-band CP pattern, possibly by preventing the phosphorylation of a nearby Ser residue by steric hindrance.
Sharka, caused by Plum pox virus (PPV), is the most detrimental viral disease of stone fruit trees. First reported from Bulgaria in 1917, the virus is now widespread in Europe, the Mediterranean Basin, and Asia Minor and is sporadically present in North and South America. On the basis of molecular and serological properties, six PPV subgroups are recognized, from which PPV-D, PPV-M, and PPV-Rec are the most common (1,2). Several apricot trees (Prunus armeniaca) showing mild, pale green rings and diffuse chlorotic spots on leaves were found in a small orchard in the Baltistan District in northern Pakistan at approximately 2,400 m above sea level. Dried leaf samples from one symptomatic tree randomly selected from the orchard were positive for PPV using double-antibody sandwich enzyme-linked immunosorbent assay with antisera prepared in the laboratory, immunoblot analysis, and reverse transcription-polymerase chain reaction (RT-PCR) targeting the capsid protein (CP) gene using standard procedures (1). To check the subgroup affiliation and evaluate the molecular variability, the 562-bp variable region spanning the C-terminus of NIb and the N-terminus of the CP was amplified, the RT-PCR product was cloned into the pGEM-T Easy vector (Promega, Madison, WI), and positive clones were analyzed by restriction and sequence analyses. Interestingly, sequence analysis of four clones revealed mixed infection, i.e., the presence of two different PPV isolates in the apricot sample. One isolate belonged to PPV-D (GenBank Accession No. DQ422147) and the other belonged to the PPV-Rec subgroup (GenBank Accession No. DQ422148). Multiple alignment of the sequenced genome portion of the Pakistan PPV-D isolate indicated 96 to 99% nt identity with various PPV-D isolates without unique, clear-cut differences. Similarly, the PPV-Rec isolate had 98 to 99% identity with European PPV-Rec isolates and retained the cross-over at nucleotide position 8450 in the 3′ terminus of NIb. This sequence had the amino acid signature at the N-terminus of the CP typical of the PPV-Rec subgroup (2). Moreover, no particular clustering of the Pakistan isolates within PPV-D and PPV-Rec could be observed after phylogenetic analysis. The DAG motif, essential for aphid transmission, was present in both sequences. To our knowledge, this is the first indication of PPV occurrence in Pakistan and first identification of the PPV-Rec isolate outside Europe. Together with previous reports on the PPV presence in China and Kazakhstan (3,4), this report indicates the need for more detailed epidemiological studies focusing the PPV spread and its molecular diversity in Asia. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) M. Glasa et al. J. Gen. Virol. 85:2671, 2004. (3) M. Navrátil et al. Plant Dis. 89:338, 2005. (4) S. Spiegel et al. Plant Dis. 88:973, 2004.
Zucchini yellow mosaic virus (ZYMV) is an emerging viral pathogen in cucurbit-growing areas wordwide. Infection causes significant yield losses in several species of the family Cucurbitaceae. To identify proteins potentially involved with resistance toward infection by the severe ZYMV-H isolate, two Cucurbita pepo cultivars (Zelena susceptible and Jaguar partially resistant) were analyzed using a two-dimensional gel electrophoresis-based proteomic approach. Initial symptoms on leaves (clearing veins) developed 6–7 days post-inoculation (dpi) in the susceptible C. pepo cv. Zelena. In contrast, similar symptoms appeared on the leaves of partially resistant C. pepo cv. Jaguar only after 15 dpi. This finding was confirmed by immune-blot analysis which showed higher levels of viral proteins at 6 dpi in the susceptible cultivar. Leaf proteome analyses revealed 28 and 31 spots differentially abundant between cultivars at 6 and 15 dpi, respectively. The variance early in infection can be attributed to a rapid activation of proteins involved with redox homeostasis in the partially resistant cultivar. Changes in the proteome of the susceptible cultivar are related to the cytoskeleton and photosynthesis.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.