The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

A 17-year-old spayed female domestic shorthair cat was referred for evaluation of severe skin lesions, including ulceration, nodule formation, erythema, and alopecia. Cutaneous nonepitheliotropic lymphoma was diagnosed histologically. There was no evidence of visceral organ involvement, but renal function was decreased. The cat was treated with lomustine (45.5 mg/m2, PO, q 21 d), and skin lesions resolved after administration of the third dose. No severe toxicoses were identified. Results suggest that lomustine may be useful for treatment of cutaneous nonepitheliotropic lymphoma in cats; however, optimal dosage, efficacy, and potential adverse effects must be determined.

RDKET induced mild to moderate gastric mucosal injuries especially in the pyloric antrum in healthy Beagles, whereas no adverse effects were observed in renal function or hemostasis. Fecal occult blood tests may be useful as screening tests for adverse gastrointestinal effects induced by RDKET in dogs.

ABSTRACT. A five-year-old West Highland white terrier dog was admitted to the teaching hospital of Nippon Veterinary and Animal Science University due to swelling and pain of the foot pads. Examinations revealed that the dog had renal failure and calcinosis circumscripta on its foot pads. The diagnosis was metastatic calcinosis circumscripta secondary to renal failure. An oral charcoal adsorbent (Kremezin ® ) was used to treat this condition. Following this treatment, a significant decrease in the Ca × P value (the serum calcium level × the serum phosphorus level) was observed, and the dog's condition improved dramatically. This case suggests that charcoal adsorbent (Kremezin ® ) may be useful for treating metastatic calcinosis circumscripta in dogs.KEY WORDS: calcinosis circumscripta, charcoal adsorbent, renal failure.

ABSTRACT. A 9-month-old intact male American cocker spaniel was referred because of hepatomegaly and ascites. Ultrasonographic evaluation of the liver revealed congestion and increased parenchymal echogenicity with focal and more hyperechoic nodules. Histopathology of the hepatic lesion revealed diffuse, ill-defined vascular proliferation. A single layer of endothelial cells, which showed signs of minimal cellular atypia, lined the irregular vessels. On immunohistochemistry, the proliferative endothelial cells lining the i rregular vessels were positive for an antiserum to factor VIII related antigen. Based on these findings, the dog was diagnosed with hepatic lymphangiomatosis.