Studies of the subsurface microbiology of the Äspö Hard Rock Laboratory, Sweden have revealed the presence of many different bacteria in the deep groundwaters which appear to maintain reducing conditions. Experiments were conducted to study the rock-water and microbial interactions. These used crushed Äspö diorite, Äspö groundwater and iron- and sulphate-reducing bacteria in flowing systems under anaerobic conditions. In column experiments, there was evidence of loss and mobilization of fine-grained crushed material (<5 μm) which had originally adhered to grain surfaces in the starting material. The mobilized fines were trapped between grains. The degree of mineralogical alteration was greater in the experiments when bacteria were present. In both column and continuously stirred reactor experiments, there is evidence for the formation of a secondary clay. These experiments have shown that microbial activity can influence rock-water interactions even in nutrient-poor conditions.
We investigated the diversity and distribution of archaeal and bacterial 16S rRNA gene sequences in deep aquifers of mid-to late Miocene hard shale located in the northernmost region of the Japanese archipelago. A major fault in the north-west-south-east (NW-SE) direction runs across the studied area. We collected three groundwater samples from boreholes on the south-west (SW) side of the fault at depths of 296, 374 and 625 m below ground level (m.b.g.l.) and one sample from the north-east (NE) side of the fault at a depth of 458 m.b.g.l. The groundwater samples were observed to be neutral and weakly saline. The total microbial counts after staining with acridine orange were in the order 10 5 − 10 6 cells mL − 1 and 10 3 cells mL − 1 in the aquifers to the SW and to the NE of the fault, respectively. A total of 407 archaeal and bacterial 16S rRNA gene sequences (204 and 203 sequences, respectively) were determined for clone libraries constructed from all groundwater samples. Phylogenetic analyses showed that the libraries constructed from the SW aquifers were generally coherent but considerably different from those constructed from the NE aquifer. All of the archaeal clone libraries from the SW aquifers were predominated by a single sequence closely related to the archaeon Methanoculleus chikugoensis , and the corresponding bacterial libraries were mostly predominated by the sequences related to Bacteroidetes, Firmicutes and δ -Proteobacteria. In contrast, the libraries from the NE aquifer were dominated by uncultured environmental archaeal clones with no methanogen sequences and by β -proteobacterial clones with no sequences related to Bacteroidetes and δ -Proteobacteria. Hence, the possible coexistence of methanogens and sulphate reducers in Horonobe deep borehole (HDB) on the SW side is suggested, particularly in . Moreover, these organisms might play an important geochemical role in the groundwater obtained from the aquifers. permeability (Fukusawa, 1987;Yamamoto et al ., 2004).An underground research laboratory (URL) is being constructed in the unique sediment by the Japan Atomic Energy Agency (JAEA), and the survey boreholes created for the URL construction are used for geophysical, geological, hydrological 204 S. SHIMIZU et al.
The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.
We collected groundwater samples at depths of up to 482 m from three boreholes drilled into sedimentary rock within two formations in Hokkaido, Japan. The prokaryotic community in each subsurface groundwater sample was analysed by microscopic counts and cloning-sequencing the 16S rRNA genes. On total direct counts, there were between 4.61 × 10(4) and 5.06 × 10(6) prokaryote cells ml(-1) in the samples, which is similar to the numbers observed at the marine subsurface. However, the vertical distribution of the prokaryotes did not show a simple decrease in abundance with increasing depth. A high abundance of cells with significant amounts of RNA was identified in the domain Bacteria using fluorescence in situ hybridization, with a high frequency of dividing cells at the transition zone between the two sedimentary rock formations. Cloning-sequencing analysis showed the predominance of γ-Proteobacteria at this transition zone at 281-312 m. The horizontal heterogeneity of the microbial distribution in the subsurface environment was also demonstrated by a relatively high density of members of the domain Archaea in borehole HDB-4, drilled only 1.5 km northeast of HDB-6 and in the same formation.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.