Turkey is one of the main grape producers in the world, with an annual production of about 4 million tons on approximately 500,000 hectares of viticulture areas, mainly in the Aegean, Southeast Anatolia, and Central Anatolia regions. Nearly 29% of the vineyards in Turkey are located in the Aegean region, with major growing districts including the provinces of Manisa and Izmir. Previous studies have shown that Grapevine leafroll-associated viruses (GLRaV-1, -2, -3, -5, -6, and -7), which cause Grapevine Leafroll Disease (GLD), were present in Turkish vineyards (1,2). Surveys in 2009 and 2011 were conducted to determine other viruses associated with this disease in commercial vineyards of the provinces of Manisa and Izmir. Leaves and young canes were randomly collected from individual symptomatic and symptomless grapevines (Vitis vinifera L.) of red or white cultivars in late summer and autumn. Symptoms observed in plants were reddening and downward rolling of leaves in red cultivars and yellowing of leaf tissue between main veins and leaf curling in white cultivars. In addition, affected grapevines appeared to have reduced growth resulting in smaller canopies. Samples were analyzed first by double antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba, Switzerland) to GLRaV-4-9 according to the manufacturer's instructions. The results from serological assays on 145 samples revealed that five samples of cv. Syrah and three of cv. Round seedless from Izmir-Menderes and from Manisa-Alasehir, respectively, reacted positively with specific antibodies to GLRaV-4-9. The identification of GLRaV-4 was confirmed by reverse transcriptase-PCR and total nucleic acids were extracted by a silica capture method from fresh, symptomatic plant samples (3). The synthesis of complementary DNA (cDNA) was performed by a Fermentas cDNA synthesis kit in accordance with the procedure specified by the manufacturer and specific primers (Forward: CCAACTGTCGTGGGTATAAGGAAT, Reverse: CCCAGACACCGGTCCTATACT) were used according to methods described by Maliogka et al. (4). An expected PCR product of approximately 200 nt was obtained from symptomatic samples that were GLRaV-4 positive in DAS-ELISA. GLRaV, comprising GLRaV-4 as quarantine pests, are under official control in Turkey. To our knowledge, this is the first report of natural GLRaV-4 infection of grapevines in Turkey. References: (1) B. Akbas et al., J. Phytopathol. 155:122, 2007. (2) N. Buzkan et al., J. Phytopathol. 158:448, 2010. (3) X. Foissac et al., Acta Hortic. 550:37, 2001. (4) V. I. Maliogka et al., J. Virol. Methods 154:41, 2008.
Bu çalışma 2009 ve 2012 yılları arasında Aydın, Balıkesir ve İzmir illerinde yaygın olarak zeytin yetiştiriciliği yapılan üretim alanlarındaki fidanlıkarda virüs hastalıklarının belirlenmesi, toplanan örneklerde virüslerin bulunma durumlarının ortaya konması amacıyla yürütülmüştür. Aydın, Balıkesir ve İzmir illerindeki fidanlıklardan her ilden 40 adet olmak üzere, toplam 120 adet fidan örneği alınmıştır. Zeytin örneklerindeki viral etmenlerin tanılanması moleküler yöntemler kullanılarak yapılmıştır. Arabis mosaic nepovirus (ArMV), Cucumber mosaic cucumovirus (CMV), Cherry leafroll nepovirus (CLRV) ve Strawberry latent ringspot nepovirus (SLRSV), Olive latent-1 virus (OLV-1), Olive latent-2 virus (OLV-2),Olive latent-3 virus (OLV-3), Olive latent ringspot virus (OLRSV) ve Olive leaf yellowing-associatedvirus (OLYaV) adlı virüslerin varlığı RT-PCR ile araştırılmıştır. Alınan fidan örneklerinde yapılan analizler sonucunda; Aydın ilinde % 32.5, Balıkesir ilinde ise % 45 ve İzmir ilinde % 35 oranlarında virüs enfeksiyonu olduğu tespit edilmiştir. Viral etmenler yönünden bakıldığı zaman; toplanan örneklerde İzmir ilinde % 27.5 CMV ve % 7.5 ArMV, Aydın ilinde % 20 CMV ve % 12.5 ArMV, Balıkesir ilinde ise % 30 CMV ve % 15 oranlarında ArMV adlı etmenlerin bulunduğu belirlenmiştir. Fidanlıklardan alınan örneklerde CLRV, SLRSV, OLV-1, OLV-2, OLRSV, OLYaV ve OLV-3 adlı virüslerin enfeksiyonunun olmadığı analizler sonucunda ortaya konmuştur.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.