In this study, we considered the efficacy of seed treatments for the inactivation of some seedborne viruses in tomato, pepper, melon, squash, bean and lettuce seeds, which are essential for human nutrition and seed production in our country. A total of 325 seed samples obtained from various farmers and foundations were tested by DAS-ELISA and RT-PCR procedures. Eight seed lots infected with Tomato mosaic tobamovirus (ToMV), Tobacco mosaic tobamovirus (TMV), Cucumber mosaic cucumovirus (CMV), Soybean mosaic potyvirus (SMV) and Lettuce mosaic potyvirus (LMV) were selected as research materials. Virus inactivation treatments were made by using acetic acid (CH 3 COOH), hydrogen peroxide (H 2 O 2 ), hydrochloric acid (HCl), sodium hypochlorite (NaClO), Triton X 100, dry heat, heated water, ozone (O 3 ), and UV (305 nm wavelength). The most effective treatments for reducing virus concentration were HCl, heated water (65 • C) and ozone (10 g m −3 ). These treatments reduced concentrations of seed-borne viruses in ranges of 51%, 42%, and 32%, respectively. Other treatments were less effective and reduced virus concentrations in the range of 27%-12%. HCl and ozone treatments were the most effective and applicable methods because they did not have negative effect on seed germination.

No abstract

Turkey is one of the main globe artichoke (Cynara cardunculus L. subsp. scolymus (L.) Hayek) producers in the world. Cultivation of this crop is done mainly in the Aegean and Eastern Marmara regions with asexually propagated cultivars such as Bayrampasa and Sakiz. More than half of total globe artichoke production in Turkey is obtained from the provinces of Izmir, Aydin, and Mugla in the Aegean region. Surveys in 2011 and 2012 were carried out to look for the presence of Artichoke yellow ringspot virus (AYRSV), Tobacco mosaic virus (TMV), and Tomato spotted wilt virus (TSWV) in the globe artichoke production areas in these three provinces. Double antibody sandwich (DAS)-ELISA and reverse transcriptase (RT)-PCR assays conducted for TMV and TSWV showed that the samples were not infected with these two viruses. Due to the lack of commercial ELISA kits against AYRSV, RT-PCR and biological indexing were used for its identification. Leaf tissues from 35 symptomatic and 25 symptomless plants were sampled and analyzed by RT-PCR using as template total RNAs extracted by a silica gel method (1). RT-PCR was conducted as previously reported (1). A PCR product of the expected size (about 530 bp) was obtained from five plant samples that were collected from Izmir province and had symptoms of bright yellow spots and line patterns on the leaves. The incidence of diseased plants in the fields ranged from 1 to 5%. In previously conducted studies, these symptoms were defined as typical symptoms of AYRSV on artichokes (2,3,4). One of the PCR products was cloned and sequenced. BLASTn analysis of the obtained sequence (GenBank Accession No. KC622054) showed 92% nucleotide identity with the partial RNA1 sequence of an AYRSV isolate from Allium cepa (AM087671.2). Furthermore, selected test plants were mechanically inoculated with sap from plant samples that were positive in RT-PCR. Chlorotic local lesions and systemic mottling symptoms were observed on Chenopodium quinoa; chlorotic lesions, mosaic, and deformation on Cucumis sativus; and systemic mosaic, reddish necrotic local lesions, and malformation on Phaseolus vulgaris (French bean). Results of the biological tests were confirmed by RT-PCR. AYRSV has a wide host range including artichoke and six other cultivated plant species and can be easily transmitted by seed, plant sap, and vegetative propagation (3). To our knowledge, this is the first report of natural infection of globe artichoke by AYRSV in Turkey. AYRSV infections can have a detrimental effect on the growth and yield of artichoke plantings. This assay will be useful for further epidemiological studies. References: (1) X. Foissac et al. Acta Hortic. 550:37, 2001. (2) D. Galliitelli et al. Adv. Virus Res. 84:289, 2012. (3) P. E. Kyriakopoulou et al. Ann. Inst. Phytopathol. Benaki 14:139, 1985. (4) V. I. Maliogka et al. Phytopathology 96:622, 2006.

No abstract

n recent years, some of artichoke growers in Aegean region of Turkey stated that globe artichoke (Cynara cardunculus L. subsp. scolymus (L.) Hayek) plants in their fields have showed virus-like symptoms. So, in order to identify viruses infecting globe artichoke, a survey was conducted between April 2011 and March 2012 and totally 50 globe artichoke samples were collected from the production areas in the mentioned region from which was provided more than 30 % of total globe artichoke production in Turkey. The samples were analyzed by DAS-ELISA, RT-PCR and biological indexing methods for Artichoke latent virus (ArLV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Broad bean wilt virus (BBWV) and Raspberry ringspot virus (RpRSV). TMV, TSWV, BBWV and RpRSV were not detected in all of samples tested. In RT-PCR, amplicons of the expected size (ca. 282 bp) were obtained from 9 out of 35 symptomatic plant samples bearing virus-like symptoms. The amplified and sequenced 9 PCR products (Accession No: KC622053) showed 86 % nucleotide sequence identity with "Artichoke latent virus mRNA unknown function (GenBank Accession No:X87255.1)" isolate in BlastN analysis. Moreover, when mechanically inoculated with the sap from plant samples, that were positive for ArLV in RT-PCR, selected test plants produced the typical symptoms of ArLV infection. As to the result of the literature review on the topic in question, this is the latest report of natural ArLV infection from globe artichoke in Turkey.

No abstract

Turkey is one of the main grape producers in the world, with an annual production of about 4 million tons on approximately 500,000 hectares of viticulture areas, mainly in the Aegean, Southeast Anatolia, and Central Anatolia regions. Nearly 29% of the vineyards in Turkey are located in the Aegean region, with major growing districts including the provinces of Manisa and Izmir. Previous studies have shown that Grapevine leafroll-associated viruses (GLRaV-1, -2, -3, -5, -6, and -7), which cause Grapevine Leafroll Disease (GLD), were present in Turkish vineyards (1,2). Surveys in 2009 and 2011 were conducted to determine other viruses associated with this disease in commercial vineyards of the provinces of Manisa and Izmir. Leaves and young canes were randomly collected from individual symptomatic and symptomless grapevines (Vitis vinifera L.) of red or white cultivars in late summer and autumn. Symptoms observed in plants were reddening and downward rolling of leaves in red cultivars and yellowing of leaf tissue between main veins and leaf curling in white cultivars. In addition, affected grapevines appeared to have reduced growth resulting in smaller canopies. Samples were analyzed first by double antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba, Switzerland) to GLRaV-4-9 according to the manufacturer's instructions. The results from serological assays on 145 samples revealed that five samples of cv. Syrah and three of cv. Round seedless from Izmir-Menderes and from Manisa-Alasehir, respectively, reacted positively with specific antibodies to GLRaV-4-9. The identification of GLRaV-4 was confirmed by reverse transcriptase-PCR and total nucleic acids were extracted by a silica capture method from fresh, symptomatic plant samples (3). The synthesis of complementary DNA (cDNA) was performed by a Fermentas cDNA synthesis kit in accordance with the procedure specified by the manufacturer and specific primers (Forward: CCAACTGTCGTGGGTATAAGGAAT, Reverse: CCCAGACACCGGTCCTATACT) were used according to methods described by Maliogka et al. (4). An expected PCR product of approximately 200 nt was obtained from symptomatic samples that were GLRaV-4 positive in DAS-ELISA. GLRaV, comprising GLRaV-4 as quarantine pests, are under official control in Turkey. To our knowledge, this is the first report of natural GLRaV-4 infection of grapevines in Turkey. References: (1) B. Akbas et al., J. Phytopathol. 155:122, 2007. (2) N. Buzkan et al., J. Phytopathol. 158:448, 2010. (3) X. Foissac et al., Acta Hortic. 550:37, 2001. (4) V. I. Maliogka et al., J. Virol. Methods 154:41, 2008.

Objective: The objective of this study was to investigate tomato spotted wilt virus (TSWV) and cucumber mosaic virus (CMV) infections in tomato and pepper plants showing virus-induced symptoms in vegetable growing districts of İzmir, Turkey. Material and Methods: Surveys were carried out in tomato and pepper plantations in 2019 and 2021, and the incidences of these viruses in the collected leaf samples were determined by RT-PCR. Nucleotide identities and phylogenetic relationships of the TSWV and CMV isolates with other isolates retrieved from the GenBank database were determined. Results: The results of this study showed that tomato plants were infected at the same rate (21.50%) with TSWV and CMV. Out of the tested pepper samples, 64.15% were infected with TSWV and 25.47% with CMV. The results showed that, the identity rate of nucleoprotein region of TSWV isolates from tomato was 99-96% at nucleotide level while the isolates from pepper showed 100-95% identity. On the other hand, the capsid protein gene region of the tomato isolate of CMV had nucleotide identity rate of 98-95% with other isolates in GenBank, while that of its pepper isolates had 100-98% identity. Also, CMV isolates of this study showed close phylogenetic relationship with the CMV isolates of subgroup IB. Conclusion: This study revealed the prevalence of TSWV and CMV in symptomatic tomato and pepper samples in İzmir province and some molecular properties of them.