The white petals of chrysanthemum (Chrysanthemum morifolium Ramat.) are believed to contain a factor that inhibits the accumulation of carotenoids. To find this factor, we performed polymerase chain reaction-Select subtraction screening and obtained a clone expressed differentially in white and yellow petals. The deduced amino acid sequence of the protein (designated CmCCD4a) encoded by the clone was highly homologous to the sequence of carotenoid cleavage dioxygenase. All the white-flowered chrysanthemum cultivars tested showed high levels of CmCCD4a transcript in their petals, whereas most of the yellow-flowered cultivars showed extremely low levels. Expression of CmCCD4a was strictly limited to flower petals and was not detected in other organs, such as the root, stem, or leaf. White petals turned yellow after the RNAi construct of CmCCD4a was introduced. These results indicate that in white petals of chrysanthemums, carotenoids are synthesized but are subsequently degraded into colorless compounds, which results in the white color.Carotenoids are 40-carbon isoprenoids with polyene chains that may contain up to 15 conjugated double bonds. More than 700 naturally occurring carotenoids have been identified (Britton et al., 2004). Carotenoids are essential for photosynthesis, and they furnish flowers and fruits with distinct colors designed to attract insects and other animals. Carotenoids also serve as precursors for the biosynthesis of the plant growth regulator abscisic acid .The chrysanthemum (Chrysanthemum morifolium Ramat.), which has been bred for more than 2,000 years, is one of the most important ornamental flowers in the world. The petal color of yellow-flowered cultivars originates mainly from carotenoids. Understanding the mechanism that controls carotenoid accumulation in petals will not only contribute greatly to the breeding of chrysanthemums and other flowering plants but also provide important information about the molecular evolutionary mechanisms responsible for different petal colors. Cultivated chrysanthemums are thought to have originated from hybrids between white-and yellow-flowered wild species. On the basis of an experiment in which white-and yellow-flowered chrysanthemums were crossed, Hattori (1991) observed that the white petal color is dominant over yellow and suggested that a single dominant gene that inhibits carotenoid accumulation may exist. The detailed function of such a gene, however, is still unknown. Kishimoto and Ohmiya (2006) demonstrated no significant difference between the expression levels of carotenoid biosynthetic genes in white and yellow petals during the course of development. In addition, the carotenoid content in immature white petals is almost equal to that in yellow petals, and the carotenoid content decreases to undetectable levels as the white petals mature. These results indicate that the formation of white color is caused neither by down-regulation nor by disruption of the carotenoid biosynthetic pathway.To find a factor that controls carotenoid content i...

Photosynthetic acclimation to CO2-limiting stress is associated with control of genetic and physiological responses through a signal transduction pathway, followed by integrated monitoring of the environmental changes. Although several CO2-responsive genes have been previously isolated, genome-wide analysis has not been applied to the isolation of CO2-responsive genes that may function as part of a carbon-concentrating mechanism (CCM) in photosynthetic eukaryotes. By comparing expression profiles of cells grown under CO2-rich conditions with those of cells grown under CO2-limiting conditions using a cDNA membrane array containing 10,368 expressed sequence tags, 51 low-CO2 inducible genes and 32 genes repressed by low CO2 whose mRNA levels were changed more than 2.5-fold in Chlamydomonas reinhardtii Dangeard were detected. The fact that the induction of almost all low-CO2 inducible genes was impaired in the ccm1 mutant suggests that CCM1 is a master regulator of CCM through putative low-CO2 signal transduction pathways. Among low-CO2 inducible genes, two novel genes, LciA and LciB, were identified, which may be involved in inorganic carbon transport. Possible functions of low-CO2 inducible and/or CCM1-regulated genes are discussed in relation to the CCM.

Chlamydomonas reinhardtii acclimates to CO 2 -limiting stress by inducing a set of genes for a carbon-concentrating mechanism (CCM). This set includes the gene Cah1, which encodes a periplasmic carbonic anhydrase. Although physiological aspects of CO 2 response have been extensively studied, regulatory components, such as transcription factors involved in the acclimation, have not been well described in eukaryotic microalgae. Using an arylsulfatase gene driven by the Cah1 promoter, a regulatory mutant of Cah1 was isolated and named lcr1 (for low-CO 2 stress response). The photosynthetic affinity for inorganic carbon of lcr1 was reduced compared with that of wild-type cells. Expression of three low-CO 2 -inducible genes, Cah1, Lci1, and Lci6, were regulated by LCR1 as shown by cDNA array and RNA gel blot analyses. The Lcr1 gene encodes a protein of 602 amino acids containing a single Myb domain, which binds to the Cah1-promoter region. Expression of Lcr1 was induced by lowering CO 2 levels and controlled by the regulatory factor CCM1. These results suggest that LCR1 transmits the low CO 2 signal to at least three CO 2 -responsive genes and then fully induces CCM.

Coexpression of two anthocyanin modification genes elicits blue flower coloration through interaction with colorless flavonoids.

Granulopoiesis is tightly regulated to meet host demands during both “steady-state” and “emergency” situations, such as infections. The transcription factor CCAAT/enhancer binding protein β (C/EBPβ) plays critical roles in emergency granulopoiesis, but the precise developmental stages in which C/EBPβ is required are unknown. In this study, a novel flow cytometric method was developed that successfully dissected mouse bone marrow cells undergoing granulopoiesis into five distinct subpopulations (#1–5) according to their levels of c-Kit and Ly-6G expression. After the induction of candidemia, rapid mobilization of mature granulocytes and an increase in early granulocyte precursors accompanied by cell cycle acceleration was followed by a gradual increase in granulocytes originating from the immature populations. Upon infection, C/EBPβ was upregulated at the protein level in all the granulopoietic subpopulations. The rapid increase in immature subpopulations #1 and #2 observed in C/EBPβ knockout mice at 1 d postinfection was attenuated. Candidemia-induced cell cycle acceleration and proliferation of hematopoietic stem/progenitors were also impaired. Taken together, these data suggest that C/EBPβ is involved in the efficient amplification of early granulocyte precursors during candidemia-induced emergency granulopoiesis.

, Lon (La) and Clp (Ti), the latter consisting of a regulatory subunit (ClpA) and a proteolytic subunit (ClpP). The gene clpB encoding an analog of ClpA had been found at 57 min on the E. coli chromosome. Cloning and examination of novel heat shock promoters led us to identify a major clpB promoter specifically controlled by a heat shock af factor, if32 (the rpoH [= htpR] gene product). I-Galactosidase synthesis from a PclpB-lacZ operon fusion was transiently induced upon temperature shift from 30 to 42°C, and the induction depended on the rpoH function. Chromosomal clpB transcripts also increased upon temperature upshift and were totally absent in the rpoH deletion strain. In the in vitro transcription experiments, the clpB promoter was specifically recognized and transcribed by RNA polymerase-iF32. Nucleotide sequencing and determination of mRNA start sites permitted us to identify a major heat shock promoter located upstream of the clpB coding sequence. The results clearly indicate that clpB expression is under direct control of Cf32. Since ClpP was recently shown to be a a32 -dependent heat shock protein, the present finding suggests the possibility that a potential ATP-dependent protease, ClpB-ClpP complex, plays an important role against thermal stress in E. coli.When Escherichia coli cells are exposed to high temperatures, a set of well-conserved heat shock proteins is transiently induced (10, 23). Induction occurs coordinately at the level of transcription (33) and is mediated by a minor cr factor, a32 (11), product of the rpoH (htpR) gene (11,22,34). About 20 heat shock proteins, whose expression is apparently under U32 control, are induced following temperature shift from 30 to 42°C, and genes for half of them have been identified and characterized (7,23). Among them are the GroEL and GroES proteins that play a key protective role against thermal stress (18), presumably by controlling formation and maintenance of higher-order protein structure (7,10). DnaK, DnaJ, and GrpE proteins work synergistically in facilitating assembly and disassembly of proteins in various processes, including DNA replication of certain phages and plasmids, autoregulation of the heat shock response, and modulation of a proteolytic system (7, 10, 28). The major cr factor (CJ70) involved in transcription of most cellular genes is partly under U32 control (29). Furthermore, ATP-dependent protease Lon (La) and a proteolytic subunit (ClpP) of another ATP-dependent protease (8) are under heat shock control mediated by (r32 (17, 23). Thus, many of the proteins that belong to the heat shock regulon play active roles in the synthesis of DNA, RNA, and protein and in protein degradation.Promoters of heat shock genes recognized by RNA polymerase containing Cu32 (EC32) exhibit characteristic sequences (at both -35 and -10 regions) that are distinct from those recognized by RNA polymerase containing u70 (EC70) (5, 10). Besides the chromosomal genes related to the heat shock response, a major promoter for the replication initiator gene (repE)...

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between –293 and –231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5′-upstream region from –651 to –231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5′-upstream region of Cah1 is discussed.

No abstract