Photosynthetic acclimation to CO2-limiting stress is associated with control of genetic and physiological responses through a signal transduction pathway, followed by integrated monitoring of the environmental changes. Although several CO2-responsive genes have been previously isolated, genome-wide analysis has not been applied to the isolation of CO2-responsive genes that may function as part of a carbon-concentrating mechanism (CCM) in photosynthetic eukaryotes. By comparing expression profiles of cells grown under CO2-rich conditions with those of cells grown under CO2-limiting conditions using a cDNA membrane array containing 10,368 expressed sequence tags, 51 low-CO2 inducible genes and 32 genes repressed by low CO2 whose mRNA levels were changed more than 2.5-fold in Chlamydomonas reinhardtii Dangeard were detected. The fact that the induction of almost all low-CO2 inducible genes was impaired in the ccm1 mutant suggests that CCM1 is a master regulator of CCM through putative low-CO2 signal transduction pathways. Among low-CO2 inducible genes, two novel genes, LciA and LciB, were identified, which may be involved in inorganic carbon transport. Possible functions of low-CO2 inducible and/or CCM1-regulated genes are discussed in relation to the CCM.

Chlamydomonas reinhardtii acclimates to CO 2 -limiting stress by inducing a set of genes for a carbon-concentrating mechanism (CCM). This set includes the gene Cah1, which encodes a periplasmic carbonic anhydrase. Although physiological aspects of CO 2 response have been extensively studied, regulatory components, such as transcription factors involved in the acclimation, have not been well described in eukaryotic microalgae. Using an arylsulfatase gene driven by the Cah1 promoter, a regulatory mutant of Cah1 was isolated and named lcr1 (for low-CO 2 stress response). The photosynthetic affinity for inorganic carbon of lcr1 was reduced compared with that of wild-type cells. Expression of three low-CO 2 -inducible genes, Cah1, Lci1, and Lci6, were regulated by LCR1 as shown by cDNA array and RNA gel blot analyses. The Lcr1 gene encodes a protein of 602 amino acids containing a single Myb domain, which binds to the Cah1-promoter region. Expression of Lcr1 was induced by lowering CO 2 levels and controlled by the regulatory factor CCM1. These results suggest that LCR1 transmits the low CO 2 signal to at least three CO 2 -responsive genes and then fully induces CCM.

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between –293 and –231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5′-upstream region from –651 to –231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5′-upstream region of Cah1 is discussed.

A few linkage maps of tea have been constructed using pseudo-testcross theory based on dominant marker systems. However, dominant markers are not suitable as landmark markers across a wide range of materials. Therefore, we developed co-dominant SSR markers from genomic DNA and ESTs and constructed a reference map using these co-dominant markers as landmarks. A population of 54 F1 clones derived from reciprocal crosses between ‘Sayamakaori’ and ‘Kana-Ck17’ was used for the linkage analysis. Maps of both parents were constructed from the F1 population that was taken for BC1 population. The order of most of the dominant markers in the parental maps was consistent. We constructed a core map by merging the linkage data for markers that detected polymorphisms in both parents. The core map contains 15 linkage groups, which corresponds to the basic chromosome number of tea. The total length of the core map is 1218 cM. Here, we present the reference map as a central core map sandwiched between the parental maps for each linkage group; the combined maps contain 441 SSRs, 7 CAPS, 2 STS and 674 RAPDs. This newly constructed linkage map can be used as a basic reference linkage map of tea.