Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.
The production and quality of Phaseolusvulgaris (snap bean) have been negatively impacted by leaf crumple disease caused by two whitefly-transmitted begomoviruses: cucurbit leaf crumple virus (CuLCrV) and sida golden mosaic Florida virus (SiGMFV), which often appear as a mixed infection in Georgia. Host resistance is the most economical management strategy against whitefly-transmitted viruses. Currently, information is not available with respect to resistance to these two viruses in commercial cultivars. In two field seasons (2018 and 2019), we screened Phaseolus spp. genotypes (n = 84 in 2018; n = 80 in 2019; most of the genotypes were common in both years with a few exceptions) for resistance against CuLCrV and/or SiGMFV. We also included two commonly grown Lima bean (Phaseolus lunatus) varieties in our field screening. Twenty Phaseolus spp. genotypes with high to moderate-levels of resistance (disease severity ranging from 5%–50%) to CuLCrV and/or SiGMFV were identified. Twenty-one Phaseolus spp. genotypes were found to be highly susceptible with a disease severity of ≥66%. Furthermore, based on the greenhouse evaluation with two genotypes-each (two susceptible and two resistant; identified in field screen) exposed to viruliferous whiteflies infected with CuLCrV and SiGMFV, we observed that the susceptible genotypes accumulated higher copy numbers of both viruses and displayed severe crumple severity compared to the resistant genotypes, indicating that resistance might potentially be against the virus complex rather than against the whiteflies. Adult whitefly counts differed significantly among Phaseolus genotypes in both years. The whole genome of these Phaseolus spp. [snap bean (n = 82); Lima bean (n = 2)] genotypes was sequenced and genetic variability among them was identified. Over 900 giga-base (Gb) of filtered data were generated and >88% of the resulting data were mapped to the reference genome, and SNP and Indel variants in Phaseolus spp. genotypes were obtained. A total of 645,729 SNPs and 68,713 Indels, including 30,169 insertions and 38,543 deletions, were identified, which were distributed in 11 chromosomes with chromosome 02 harboring the maximum number of variants. This phenotypic and genotypic information will be helpful in genome-wide association studies that will aid in identifying the genetic basis of resistance to these begomoviruses in Phaseolus spp.
Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.
Summer squash (Cucurbita pepo L.) is a major vegetable crop produced in Georgia and Florida during the fall season. This production is vulnerable to whitefly (Bemisisia tabaci Genn.)-transmitted viruses that lead to severe yield losses. Over the past several years, whitefly populations have increased during the fall, thus leading to an increase in whitefly-transmitted viruses such as Cucurbit leaf crumple virus (CuLCrV) and Cucurbit yellow stunting disorder virus (CYSDV). Whitefly management for summer squash relies on the use of insecticides and can be costly without providing adequate management of the viruses. Deployment of host resistance to whiteflies and their transmitted viruses (CuLCrV and CYSDV) is the best strategy for mitigating yield loss of summer squash; however, no resistant cultivars are commercially available. In the current study, resistance or tolerance to whiteflies, CuLCrV, and CYSDV was determined for squash germplasm from the U.S. Department of Agriculture (USDA) Germplasm Resources Information Network (GRIN), university breeding programs, and commercial companies in Georgia and Florida across 2 years. In both locations and years, visual virus symptom severity scores were collected and a quantitative polymerase chain reaction (qPCR) was used to determine the CuLCrV viral load and CYSDV presence in Georgia. Whitefly-induced feeding damage was evaluated by directly assessing the intensity of silverleaf symptoms and visual counts of whitefly adults on the foliage in the field or in photographs. Virus symptom severity was lower in C. moschata Duchesne ex Poir. genotypes, namely, PI 550689, PI 550692, PI 550694, PI 653064, and Squash Betternut 900, than in other evaluated genotypes. Two C. pepo accessions were common between both locations for viral severity (PI 442294) or viral severity and viral load (PI 171625). Lower CuLCrV loads were identified in C. ecuadorensis Cutler & Whitaker (PI 540895), and C. okeechobeensis (Small) L.H.Bailey (PI 540900) than other evaluated genotypes. Four genotypes tested negative for CYSDV during both years: C. pepo (PI 507882), C. moschata (PI 483345), C. ecuadorensis (PI 390455), and C. okeechobeensis (PI 540900); they are potential sources of resistance. Six C. moschata accessions (PI 211999, PI 550690, PI 550692, PI 550694, PI 634982, and PI 653064) showed high tolerance to silverleaf disorder and had the lowest adult whitefly counts. Collectively, the accessions identified in the current study are potential sources of resistance or tolerance to whitefly and whitefly-transmitted viruses (CuLCrV and CYSDV).
Cucurbit chlorotic yellows virus (CCYV) belongs to the genus Crinivirus and is part of a complex of whitefly-transmitted viruses that cause yellowing disease in cucurbits. In the southeastern USA, heavy incidences of CCYV have been observed on all cucurbits grown in the fall. CCYV was detected from wild radish (Raphanus raphanistrum L.), a common weed that grows in the southeastern USA by high-throughput sequencing as well as RT-PCR. CCYV sequence from wild radish was 99.90% and 99.95%, identical to RNA 1 and RNA 2 of cucurbit isolates of CCYV from the region. Transmission assays using whiteflies demonstrated that wild radish is a good host for CCYV. Whiteflies were also able to acquire CCYV from wild radish and transmit the virus to cucurbit hosts, which developed typical symptoms associated with CCYV. Using quantitative PCR, the titer of CCYV in wild radish was also estimated to be on par with that of cucurbit hosts of the virus. Whitefly bioassays revealed that wild radish is an acceptable feeding and reproductive host plant. These results indicate that wild radish could serve as a reservoir host for CCYV in the USA and other parts of the world where similar conditions exist.
Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state’s economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5’TCCACAAGCTTGATGGA- GGG3’) and WCLaV-1RP (5’TCCCGAGTGAGGAAGCTAGT3’). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.
Cucurbits in Southeastern USA have experienced a drastic decline in production over the years due to the effect of economically important viruses, mainly those transmitted by the sweet potato whitefly (Bemisia tabaci Gennadius). In cucurbits, these viruses can be found as a single or mixed infection, thereby causing significant yield loss. During the spring of 2021, surveys were conducted to evaluate the incidence and distribution of viruses infecting cantaloupe (n = 80) and watermelon (n = 245) in Georgia. Symptomatic foliar tissues were collected from six counties and sRNA libraries were constructed from seven symptomatic samples. High throughput sequencing (HTS) analysis revealed the presence of three different new RNA viruses in Georgia: cucumis melo endornavirus (CmEV), cucumis melo amalgavirus (CmAV1), and cucumis melo cryptic virus (CmCV). Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed the presence of CmEV and CmAV1 in 25% and 43% of the total samples tested, respectively. CmCV was not detected using RT-PCR. Watermelon crinkle leaf-associated virus 1 (WCLaV-1), recently reported in GA, was detected in 28% of the samples tested. Furthermore, RT-PCR and PCR analysis of 43 symptomatic leaf tissues collected from the fall-grown watermelon in 2019 revealed the presence of cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus (CuLCrV) at 73%, 2%, and 81%, respectively. This finding broadens our knowledge of the prevalence of viruses in melons in the fall and spring, as well as the geographical expansion of the WCLaV-1 in GA, USA.
RNA silencing is a crucial mechanism of the antiviral immunity system in plants. Small RNAs guide Argonaut proteins to target viral RNA or DNA, preventing virus accumulation. Small RNA profiles in Cucurbita pepo line PI 420328 with tolerance to cucurbit yellow stunting disorder virus (CYSDV) were compared with those in Gold Star, a susceptible cultivar. The lower CYSDV symptom severity in PI 420328 correlated with lower virus titers and fewer sRNAs derived from CYSDV (vsRNA) compared to Gold Star. Elevated levels of 21- and 22-nucleotide (nt) size class vsRNAs were observed in PI 420328, indicating more robust and efficient RNA silencing in PI 420328. The distribution of vsRNA hotspots along the CYSDV genome was similar in both PI 420328 and Gold Star. However, the 3’ UTRs, CPm, and p26 were targeted at a higher frequency in PI 420328.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.