First Report of Cucurbit Chlorotic Yellows Virus in Association with Other Whitefly-Transmitted Viruses in Yellow Squash (Cucurbita pepo) in Georgia, U.S.A.

Abstract

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA

“…There is no actual estimate of losses in dollars due to the complexity of whiteflytransmitted virus diseases, but the amount is believed to be in the tens of millions of dollars [2]. Two whitefly-transmitted viruses (WTVs), CuLCrV [3] and CYSDV [4], were previously reported to infect cucurbits in the state, whereas CCYV was first reported in Georgia this year (2021) [6].…”

“…The consistent detection of CuLCrV and CYSDV on symptomatic cucurbit samples led to the assumption that these were the only viruses responsible for losses in the state. However, another crinivirus, CCYV that produces symptoms virtually identical to those of CYSDV, was detected recently on squash grown in Tift County [6]. Discovered in Japan in 2004 [50], CCYV was believed to be restricted to Asia [50,51], Africa [52], and the Mediterranean regions of Europe [53,54] until it was recently identified in the Imperial Valley of California [55].…”

“…Based on crop loss estimates in 2016 and 2017, several millions of dollars were lost due to whiteflies and the viruses they transmit in cucurbits (cantaloupe, yellow squash, and zucchini) and beans (Phaseolus vulgaris L.) [2]. Whitefly-transmitted viruses reported from the state, and infecting cucurbits include cucurbit leaf crumple virus (CuLCrV) [3], cucurbit yellow stunting disorder virus (CYSDV) [4], sida golden mosaic 2 of 17 virus (SiGMV) [5], and cucurbit chlorotic yellows virus (CCYV) [6]. Recently, the thripstransmitted tobacco streak virus was also identified on yellow squash in Georgia [7].…”

Field Evaluation of Cucurbita Germplasm for Resistance to Whiteflies and Whitefly-transmitted Viruses

“…Efforts to manage whiteflies usually rely on weekly applications of insecticides that often result in minimal control when the insect population is high (Nakhla and Maxwell, 1998). As of 2020, four whitefly-transmitted viruses have been detected in Cucurbits in Georgia and Florida: CuLCrV, CYSDV, Squash vein yellowing virus (SqVYV), and Cucurbit chlorotic yellows virus (CCYV) (Adkins et al, 2011;Gadhave et al, 2018;Jailani et al, 2021;Kavalappara et al, 2021b).…”

“…Symptoms of CYSDV include chlorotic spots on older leaves that lead to interveinal chlorosis, brittle leaves, upward rolling of leaves, and stunting. The CCYV is also a species in the genus Crinivirus and produces foliar symptoms similar to those of CYSDV (Kavalappara et al, 2021b). The SqVYV is a species in the genus Ipomovirus and family Potyviridae.…”