It is generally assumed that the quality of X-ray diffraction data can be improved by merging data sets from several crystals. However, this effect is only valid if the data sets used are from crystals that are structurally identical. It is found that frozen macromolecular crystals very often have relatively low structure identity (and are therefore not isomorphous); thus, to obtain a real gain from multi-crystal data sets one needs to make an appropriate selection of structurally similar crystals. The application of hierarchical cluster analysis, based on the matrix of the correlation coefficient between scaled intensities, is proposed for the identification of isomorphous data sets. Multi-crystal single-wavelength anomalous dispersion data sets from four different protein molecules have been probed to test the applicability of this method. The use of hierarchical cluster analysis permitted the selection of batches of data sets which when merged together significantly improved the crystallographic indicators of the merged data and allowed solution of the structure.

ISPyB is now a multisite, generic LIMS for synchrotron-based MX experiments. Its initial functionality has been enhanced to include improved sample tracking and reporting of experimental protocols, the direct ranking of the diffraction characteristics of individual samples and the archiving of raw data and results from ancillary experiments and post-experiment data processing protocols. This latter feature paves the way for ISPyB to play a central role in future macromolecular structure solution pipelines and validates the application of the approach used in ISPyB to other experimental techniques, such as biological solution Small Angle X-ray Scattering and spectroscopy, which have similar sample tracking and data handling requirements.

A powerful and easy-to-use workflow environment has been developed at the ESRF for combining experiment control with online data analysis on synchrotron beamlines. This tool provides the possibility of automating complex experiments without the need for expertise in instrumentation control and programming, but rather by accessing defined beamline services.

No abstract

A reliable and reproducible method to automatically characterize the radiation sensitivity of macromolecular crystals at the ESRF beamlines has been developed. This new approach uses the slope of the linear dependence of the overall isotropic B-factor with absorbed dose as the damage metric. The method has been implemented through an automated procedure using the EDNA online data analysis framework and the MxCuBE data collection control interface. The outcome of the procedure can be directly used to design an optimal data collection strategy. The results of tests carried out on a number of model and real-life crystal systems are presented.

A systematic study of the sensitivity to radiation damage of crystals held at room temperature for a large set of model macromolecular structures is presented.

The Liquids Reflectometer at Oak Ridge National Laboratory's Spallation Neutron Source provides neutron reflectivity capability for an average of about 30 experiments each year. In recent years, there has been a large effort to streamline the data processing and analysis for the instrument. While much of the data reduction can be automated, data analysis remains something that needs to be done by scientists. For this purpose, we present a reflectivity fitting web interface that captures the process of setting up and executing fits while reducing the need for installing software or writing Python scripts.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.