Background:Onychomycosis is a fungal disease of the nail apparatus caused by both dermatophytic and nondermatophytic strains. Treatment involves long duration antifungal therapy. However, long treatment duration without identifying the causative species may lead to resistance. Confirmation of diagnosis and speciation by culture before administering antifungal therapy is ideal.Aims:To study the clinical and epidemiological aspects of onychomycosis in Hadoti region (south-east Rajasthan) and identify various mycological strains and predisposing factors causing onychomycosis.Materials and Methods:A prospective study of clinically diagnosed cases of onychomycosis attending the outpatient Department of Dermatology in our institute conducted from June 2012 to May 2013. The clippings were subjected to potassium hydroxide (KOH) examination and culture in the appropriate medium.Results:A total of 150 cases were enrolled in our study. There were 110 males (73.33%) and 40 females (26.66%) and male to female ratio was 2.75:1. The total dystrophic onychomycosis was the most common presentation seen in the majority of cases (46%) followed by distal lateral subungual onychomycosis in 52 cases (34.6%), mixed onychomycosis in 16 cases (10.66%), superficial white onychomycosis in 11 cases (7.33%), and proximal subungual onychomycosis in 2 cases. None had the endonyx variant. Direct microscopic examination of the nail clipping mounted with 40% KOH demonstrated fungal elements in 83 (55.33%) cases. Rate of isolation of organisms by culture was 64%. Nondermatophytes were isolated in 53 (35.33%), dermatophytes in 28 (18.66%), and yeasts in 15 (10%) of cases. The most commonly isolated species was Aspergillus in 45 (30%) cases. Aspergillus flavus was more commonly isolated compared to Aspergillus niger.Conclusion:The nondermatophyte molds appear to be more common causative agents of onychomycosis compared to usual dermatophyte species in south-east Rajasthan. Our study re-emphasizes the importance of culture for diagnosis of onychomycosis in every suspected case prior to therapy.

A n 85-year-old man presented to the emergency department with difficulty walking, dizziness and double vision that had lasted for one week. He had previously experienced several weeks of temporal headache and weight loss. Abnormal findings on neur o logic examination included upbeat nystagmus, gaze palsy when looking to the right and gait ataxia.Diffusion-weighted magnetic resonance imaging (MRI) showed multiple, small, acute and subacute infarcts in the pons, cerebellar hemispheres and occipital lobes. A computed tomography (CT) angiogram showed bilateral concentric thickening of the walls of the vertebral arteries extracranially (Figure 1) with irregular, concentric stenoses of these arteries from the subclavian artery to the upper cervical vertebrae. The radiologic differential diagnosis included bilateral dissection of the vertebral arteries, but it did not include giant cell arteritis. Our patient was given treatment with intravenous heparin, followed by warfarin for the presumed dissection. After four weeks in hospital, he was discharged to a stroke rehabilitation facility.Six weeks after being discharged from hospital, the patient was readmitted with a decreased level of consciousness, dysarthria and worsening ataxia. A diffusion-weighted MRI showed new infarcts in the pons, cerebellum and midbrain. A magnetic resonance angiogram showed severely diminished blood flow in his basilar artery, as well as extensive multifocal areas of diminished flow within the vertebral arteries. A new, moderately severe, area of stenosis within the petrous portion of his left internal carotid artery was evident (Figure 2).The rapid progression of changes in the large vessels led to the consideration of vasculitis as a possible diagnosis. Our patient's erythrocyte sedi mentation rate was 30 mm/h (the upper limit of normal varies between laboratories, but it is 6 mm/h at our institution) and his C-reactive protein level was 25 (normal < 8) mg/L. When adjusted for age, the erythrocyte sedimentation rate could be interpreted as normal (upper limit of normal of the the age-adjusted rate for men is calculated as age in years ÷ 2; for women, it is calculated as [age in years + 10] ÷ 2). 1 His hemoglobin level was normal, and laboratory markers of systemic vasculitis were negative.Given the initial involvement of large, extracranial arteries, our patient's advanced age and his continued weight loss, giant cell arteritis rather than primary central nervous system angiitis became our working diagnosis. Treatment Practice CMAJ • Given the wide spectrum of presentations of giant cell arteritis, physicians need to be equally familiar with both typical and atypical presentations.• The presenting manifestation of giant cell arteritis may be stroke. Giant cell arteritis should be considered as a cause of stroke in patients with "red flags."• Concentric, long-segment, increased thickening of the arterial wall, particularly extracranially, on computed tomography angiography may indicate giant cell arteritis. See related practice article by B...

Background: Currently, the studies related to hair loss in children showed the variable prevalence of different clinical patterns and causes of scalp hair loss, that had regional variation. Aims: The aim of this study is to evaluate the epidemiology and clinical pattern of scalp hair loss in children (0–18 years age group). Materials and Methods: A total of 300 children presenting with scalp hair loss were studied during a period of 1 year from April 2015 to March 2016. The results were recorded and analyzed. Results: The most common disorder found in this study was tinea capitis seen in 166 (55.33%) cases followed by alopecia areata, seborrheic dermatitis, pediculosis with secondary infection. Other uncommon causes were lichen planopilaris, tractional alopecia, telogen effluvium, nevus sebaceous, occipital neonatal alopecia, ectodermal dysplasia, scalp psoriasis, trichotillomania, and alopecia due to nutritional deficiency. Several other rare causes were identified in this study. Conclusion: This study showed that hair loss in children in our region is not an uncommon problem and results from a variety of causes. Early diagnosis and treatment are needed to prevent further hair loss and to avoid irreversible hair loss and scarring alopecia. As has been observed in this study, hair problem may be due to important nutritional deficiency. We should be aware of such presentation. These may be a clue to the diagnosis of systemic illness.

No abstract

Background:Knowledge about the current patterns of sexually transmitted infections (STIs) is essential as they pose a major health problem worldwide and even more so in the developing countries like ours. Owing to the lack of advanced laboratory facilities at most of the centers, the cases are evaluated and managed as per the syndromic approach proposed by the National AIDS Control Organization.Aims:We aim to study the patterns of STIs seen over the past 4 years based on the syndromic approach.Materials and Methods:A retrospective analysis of the data of STI clinic over 4 years (April 2012–March 2016) was carried out. Showing all cases attending STI clinic are subjected to clinical examinations and investigated. Tests for HIV and venereal disease research laboratory were performed in all patients. STIs were categorized as per the syndromic approach. The proportions were calculated and data collected were analyzed.Results:A total of 4847 cases (1845 males and 3002 females) were studied. The most common STI overall was cervicovaginal discharge followed by genital herpes, warts, molluscum contagiosum, genital ulcerative disease-nonherpetic, lower abdominal pain, and urethral discharge in decreasing order of frequency. Genital herpes was the most common STI in males. Collectively, the proportion of viral STI was more as compared to nonviral STI. The number of newly diagnosed HIV cases was 19 (0.4%).Conclusion:The contemporary trend of STIs is relative rise in the proportion of viral STIs including genital herpes, warts, and molluscum contagiosum. Since STIs and HIV perpetuate each other, prompt diagnosis and adequate treatment of all cases of STIs is necessary to prevent HIV transmission.

Leprosy caused by uncultivable mycobacterial pathogen Mycobacterium leprae is primarily diagnosed clinically due to lack of simple and sensitive diagnostic tools. Recently, Mycobacterium lepromatosis has also been identified as the causative organism of leprosy in Mexico and the Caribbean region. 1,2 However, sporadic cases have also been reported from the British Isles, 3 Brazil and Myanmar, 4 Canada, 5 and Singapore, 6 raising speculations that the geographic distribution of M. lepromatosis could be broader than what is currently known. Initially a two-step nested polymerase chain reaction (PCR) assay was developed for detecting M. leprae and M. lepromatosis which was based on 16S rRNA sequences; however, these sequences differ by only few bases and require confirmation by Sanger sequencing. 1 Species-specific loci such as repetitive element RLEP for M. leprae 7 or hemN gene for M. lepromatosis are targeted for molecular diagnostics. 8 Recently, Sharma et al. 9 have developed a quantitative PCR-based detection method which targets a specific genomic region likely to be present in multiple copies in the M. lepromatosis genome. However, all these assays require at least two different primers to detect M. lepromatosis and M. leprae in separate PCR reactions, making this exercise more labor-intensive and time-consuming. 9,10 Currently, this is one of the main reasons that most laboratories do not screen for M. lepromatosis routinely, which limits our understanding of the true extent of distribution of leprosy bacilli (M. leprae and M. lepromatosis) in different geographic regions, especially in many endemic regions. So far, there is no assay that can simultaneously detect and differentiate these two leprosy bacilli. Comparative genomic analysis between the rpoT gene of M. leprae and M. lepromatosis reveals a 45-bp segment ([AATACAGCATCTCGAGCCACC] 2 CCA) flanked by conserved sequences which is absent in the M. leprae rpoT gene. 11 This genomic region reveals the sequences where both species of leprosy bacilli can be differentiated easily. Therefore, we designed a novel primer pair to simultaneously detect and differentiate these two closely related mycobacterial species targeting the flanking region of this deletion in rpoT in a single PCR step and differentiate them by amplicon size. | ME THODSThe location of primer design was determined by the rpoT sequence alignment of different reference strains of M. leprae, namely M. leprae

<p class="abstract"><strong>Background:</strong> Melasma is an acquired increased pigmentation of the skin, characterized by gray-brown symmetrical patches, mostly in the sun-exposed areas of the skin.</p><p class="abstract"><strong>Methods:</strong> The proposed study is an epidemiological cross sectional study which was carried out in the department of dermatology in a teaching institute from October 2007 to September 2008 at Pramukh Swami Medical College, Karamsad, Gujarat. A total of 60 patients were enrolled for the study over a period of one year.<strong></strong></p><p class="abstract"><strong>Results:</strong> The main age group affected was 30-39 years i.e. 48.33% patients. 50 patients were females.18 patients had a positive family history of melasma. 12 patients had a positive history of using OC Pills. Malar region was the commonest affected area found in 52 patients followed by Centro-facial in 31 and least involvement was seen in forehead region in 24 patients. 20 patients reported association of occurrence of the lesions with pregnancy, 09 patients reported sunlight to be the offending agent.</p><p class="abstract"><strong>Conclusions:</strong> Females were affected more commonly during their late third decade of life. Although we did not find the exact cause of melasma, we noticed that sun-exposure, pregnancy, and taking of oral contraceptive pills could precipitate or exacerbate the melasma.</p>

No abstract