The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying bla CTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying bla CTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group.CTX-M-type enzymes were reported in Germany and Argentina in 1989, and so far, more than 67 CTX-M-type ␤-lactamases have been identified, mostly in Escherichia coli, Klebsiella pneumoniae, and Salmonella enterica serovar Typhimurium isolates (http://www.lahey.org). The global spread is now a major concern in certain areas such as Latin America, Asia, Europe, Africa, and North America (5).Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated among Enterobacteriaceae family isolates in Turkey (1, 10). The aim of this study was to determine the current prevalence of the CTX-M-1 group and the molecular characteristics in E. coli clinical isolates in a university hospital in Istanbul, Turkey.(This work was presented in part as a poster at the "Microbes in a Changing World" Congress of the International Union of Microbiological Societies (IUMS), San Francisco, CA, 23 to 28 July 2005.)A total of 1,010 consecutive nonrepetitive isolates of E. coli obtained from inpatients and outpatients at the hospital of Istanbul Faculty of Medicine over a 2-year period (2002 to 2004) were screened for extended-spectrum ␤-lactamase (ESBL) production, using the double-disc synergy test. A total of 61 E. coli isolates (27 from inpatients and 34 from outpatients) with ESBL phenotypes were included in this study, the majority of which were from the urine and respiratory specimens of patients treated in six different medical and surgical wards.MICs were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone, and ceftazidime used alone and in combination were determined, with 4 g/ml clavulanic acid for phenotypic detection of ESBLs.Conjugation experiments for the transfer of cefotaxime resistance were carried out with all CTX-M-1-producing E. coli isolates (8). Crude extracts of ␤-lactamases were subjected to isoelectric focusing (IEF) (3).All isolates were screened for the CTX-M-1 group (13) and bla TEM (16) and bla SHV (9). Strains which had pI bands at 7.3 were subjected to bla OXA-1 -like PCR using the primers OXA-1-A (5Ј-GAATCGCATTATCACTTATGG-3Ј) and OXA-1-B (5Ј-GATACATGTTCTCTATGG-3Ј; this study). PCR amplicons for linking ISEcp1 with bla CTX-M were obtained by anchoring one primer at the 3Ј end of bla CTX-M (bla CTX-M reverse, 5ЈCACTTTGTCGTCTAAGGCG3Ј) and the other to the 5Ј end of ISEcp1 (5ЈAATACTACCTTGGCTTTCTGA3Ј).Sequencing was carried out with both strands by using the dideoxy chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using a Lasergene DNASTAR software package. Sequence alignments were done u...

The presence of PER-1- and OXA-10-like beta-lactamases was investigated by PCR in 49 ceftazidime-resistant Pseudomonas aeruginosa isolates from patients hospitalised in the 24-bed general intensive care unit of the Istanbul Faculty of Medicine during a 12-month period between February 1999 and February 2000. The clonal relatedness of the isolates was investigated by random amplified polymorphic DNA (RAPD) analysis, and the sequences of the PER-1 and OXA genes from all isolates were determined. The rates of resistance of the isolates to imipenem, aztreonam and cefepime were 98%, 92% and 96%, respectively, and to piperacillin and piperacillin-tazobactam were 41% and 37%, respectively. Using the double-disk synergy test, 37% (18/49) of the isolates were identified as extended-spectrum beta-lactamase producers. The PER-1 gene was identified in 86% (42/49) and the OXA-10 gene in 55% (27/49) of the ceftazidime-resistant isolates. Of isolates carrying the PER-1 gene, 48% (20/42) also carried the OXA-10 gene. The respective nucleotide sequences were identical for each isolate. Sixteen RAPD patterns were detected among the PER-1-positive isolates, but 60% (25/42) of the PER-1-positive isolates belonged to two distinct patterns, while the remainder exhibited a wide clonal diversity. The results indicated that the prevalence of PER-1- and OXA-10-like beta-lactamases remains high among ceftazidime-resistant P. aeruginosa isolates in Turkey.

No abstract

No abstract

The in vitro activities of ciprofloxacin, ofloxacin, norfloxacin, levofloxacin and gemifloxacin against 343 clinical isolates were compared. Gemifloxacin showed the greatest activity, with MIC90 values as low as 0.03-0.25 mg/L against Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, methicillin-susceptible Staphylococcus aureus and Klebsiella pneumoniae, while methicillin-resistant Staphylococcus aureus, Enterococcus spp., Pseudomonas spp., Acinetobacter spp., Escherichia coli and Enterobacter spp. strains exhibited low rates of susceptibility to all five fluoroquinolones.