No abstract

Resistance rates to amikacin, ciprofloxacin, ceftazidime, cefepime, imipenem, cefoperazone/sulbactam and piperacillin/tazobactam in Escherichia coli (n= 438), Klebsiella pneumoniae (n= 444), Pseudomonas aeruginosa (n= 210) and Acinetobacter baumanni (n=200) were determined with e-test in a multicenter surveillance study (Hitit-2) in 2007. ESBL production in Escherichia coli and K. pneumoniae was investigated following the CLSI guidelines. Overall 42.0% of E.coli and 41.4% of K. pneumoniae were ESBL producers. In E. coli , resistance to imipenem was not observed, resistance to ciprofloxacin and amikacin was 58.0% and 5.5% respectively. In K. pneumoniae resistance to imipenem, ciprofloxacin and amikacin was 3.1%, 17.8% 12.4% respectively. In P. aeruginosa the lowest rate of resistance was observed with piperacillin/tazobactam (18.1%). A. baumanni isolates were highly resistant to all the antimicrobial agents, the lowest level of resistance was observed against cefoperazone/sulbactam (52.0%) followed by imipenem (55.5%). this study showed that resistance rates to antimicrobials are high in nosocomial isolates and show variations among the centers.

The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying bla CTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying bla CTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group.CTX-M-type enzymes were reported in Germany and Argentina in 1989, and so far, more than 67 CTX-M-type ␤-lactamases have been identified, mostly in Escherichia coli, Klebsiella pneumoniae, and Salmonella enterica serovar Typhimurium isolates (http://www.lahey.org). The global spread is now a major concern in certain areas such as Latin America, Asia, Europe, Africa, and North America (5).Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated among Enterobacteriaceae family isolates in Turkey (1, 10). The aim of this study was to determine the current prevalence of the CTX-M-1 group and the molecular characteristics in E. coli clinical isolates in a university hospital in Istanbul, Turkey.(This work was presented in part as a poster at the "Microbes in a Changing World" Congress of the International Union of Microbiological Societies (IUMS), San Francisco, CA, 23 to 28 July 2005.)A total of 1,010 consecutive nonrepetitive isolates of E. coli obtained from inpatients and outpatients at the hospital of Istanbul Faculty of Medicine over a 2-year period (2002 to 2004) were screened for extended-spectrum ␤-lactamase (ESBL) production, using the double-disc synergy test. A total of 61 E. coli isolates (27 from inpatients and 34 from outpatients) with ESBL phenotypes were included in this study, the majority of which were from the urine and respiratory specimens of patients treated in six different medical and surgical wards.MICs were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone, and ceftazidime used alone and in combination were determined, with 4 g/ml clavulanic acid for phenotypic detection of ESBLs.Conjugation experiments for the transfer of cefotaxime resistance were carried out with all CTX-M-1-producing E. coli isolates (8). Crude extracts of ␤-lactamases were subjected to isoelectric focusing (IEF) (3).All isolates were screened for the CTX-M-1 group (13) and bla TEM (16) and bla SHV (9). Strains which had pI bands at 7.3 were subjected to bla OXA-1 -like PCR using the primers OXA-1-A (5Ј-GAATCGCATTATCACTTATGG-3Ј) and OXA-1-B (5Ј-GATACATGTTCTCTATGG-3Ј; this study). PCR amplicons for linking ISEcp1 with bla CTX-M were obtained by anchoring one primer at the 3Ј end of bla CTX-M (bla CTX-M reverse, 5ЈCACTTTGTCGTCTAAGGCG3Ј) and the other to the 5Ј end of ISEcp1 (5ЈAATACTACCTTGGCTTTCTGA3Ј).Sequencing was carried out with both strands by using the dideoxy chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using a Lasergene DNASTAR software package. Sequence alignments were done u...

Overall, amoxicillin/clavulanic acid and levofloxacin were the most active antibiotics based on all three breakpoints against these pathogens. Although susceptibility was not universally low in Turkey, high resistance rates were found in S. pneumoniae and, when using PK/PD and EUCAST breakpoints, in other respiratory pathogens.

Carbapenems are the choice of treatment in infections caused by multidrug resistant Enterobacteriaceae. In recent years carbapenem-resistant Enterobacteriaceae isolates due to carbapenemases have been increasingly reported worldwide. Multicenter studies on carbapenemases are scarce in Turkey. The aim of this study was to determine the distribution of carbapenemases from different parts of Turkey as a part of the European Survey of Carbapenemase Producing Enterobacteriaceae (EuSCAPE) project. Beginning in November 2013, carbapenem-resistant isolates resistant to at least one of the agents, namely imipenem, meropenem, and ertapenem were sent to the coordinating center. Minimum inhibitory concentrations for these carbapenems were determined by microdilution tests following EUCAST guidelines. Production of carbapenemase was confirmed by combination disk synergy tests. Types of carbapenemases were investigated using specific primers for VIM, IMP; NDM, KPC and OXA-48 genes by multiplex polymerase chain reaction. In a six month period, 155 suspected carbapenemase-positive isolates were sent to the coordinating center of which 21 (13.5%) were E.coli and 134 (86.5%) were K.pneumoniae. Nineteen (90.5%) strains among E.coli and 124 (92.5%) strains among K.pneumoniae were shown to harbour at least one carbapenemase gene by molecular tests, with a total of 92.3% (143/155). Carbapenemases were determined as a single enzyme in 136 strains (OXA-48: 84.6%; NDM: 6.3%; VIM: 2.8%; IMP: 1.4%) and as a combination in seven isolates (OXA-48 + NDM: 2.1%; OXA-48 + VIM: 2.1%; VIM + NDM: 0.7%). KPC was not detected in any of the isolates. According to the microdilution test results, resistance to imipenem, meropenem and ertapenem in OXA-48 isolates were 59.5%, 52.9% and 100%, respectively. The combination disk synergy test was 100% compatible with the molecular test results. As most of the OXA-48 producing isolates were susceptible to meropenem but all were resistant to ertapenem, ertapenem seems to be the most sensitive agent in screening carbapenemases in areas where OXA-48 is prevalent and phenotypic combination tests can be useful in centers where molecular tests are not available.

Background: Two OXA-48-producing Klebsiella pneumoniae isolates(KP-4936 and KP-154488) were analyzed. Method: Minimum inhibitory concentrations were determined using agar dilution and E-test, β-lactamase production by phenotypic tests (E-test MBL and ESBL, isoelectric focusing, and bioassay) and molecular methods (PCR, RAPD-PCR, sequencing, plasmid analysis, and conjugation). Results: Isolateswere resistant to all β-lactams, including carbapenems. PCR and sequencing identifiedbla_OXA-48in bothisolates and the transconjugant. KP-4936 harbored bla_TEM-1 (pI 5.4) and bla_CTX-M-15 genes (pI 8.6), while KP-154488 was positive for bla_TEM-1 (pI 5.4), bla_CTX-M-15 (pI 8.9), and bla_SHV2a (pI 7.6), in addition. The enzyme with a pI of 7.2 hydrolyzed imipenem according to a bioassay result. Plasmids (70 and 140 kb) from KP-4936 were transferred by conjugation. RAPD-PCR found no clonal relationship between the two strains. Conclusion: Carbapenem resistance may spread among Enterobacteriaceaevia the transferable enzyme OXA-48.

No abstract

Carbapenem non-susceptible Pseudomonas aeruginosa and Acinetobacter baumannii strains were tested for the presence of metallo-beta-lactamases (MBLs) by EDTA-synergy screening. Imipenem hydrolysis was investigated by a bioassay and IMP-/VIM-encoding genes by PCR. No bla(IMP/VIM) related genes or imipenemase activity were detected although E-test found all strains as MBL-positive. Disk synergy tests with 0.5 M EDTA determined 63.6-100%, while those with 0.1 M EDTA detected 0-7.7% of isolates as MBL producers. Most strains were susceptible to EDTA. In conclusion, for MBL-screening purposes, EDTA-synergy results change with molarity of EDTA, but even if some false positives are encountered, 0.1 M EDTA seems to be acceptable.