A successful rice production on swampland would require a planting material from high yielding varieties adaptated to the swampy ecosystem. This study was carried out to compare the growth and yield characteristics of five rice lines and a check variety as grown on non-tidal swampland. The lines were F4 generation of bulk selection from the crosses involving Bengkulu swamp rice landraces (Hanafi Putih, Tigo-tigo, Harum Curup, and Lubuk Durian) and high yielding varieties for the irrigated field (Sidenuk and Bestari). The trial was conducted on a shallow non-tidal swampland with stagnant inundation no more than 50 cm in depth often occurred during the plant life cycle. The lines and the check variety (Inpara 4) were arranged in a randomized complete block design with three replications. Observations were made for the agronomic performances of the plant, including plant height, total tiller number clump-1, effective tiller number clump-1, heading date, maturity date, panicle length, grain number panicle-1, 100-grain weight, and grain yield clump-1. Significant variation among the genotypes was found for all observed traits. On average, the evaluated lines showed comparable growth and yield performances to the check variety. Tigo-tigo × Bestari was the tallest line and potential for medium depth swampland. This line showed good overall agronomic performances and yielded relatively higher than the check variety, but delayed in attaining maturity. For shallow swampland, Hanafi Putih x Sidenuk exhibited the most potent line by having good overall agronomic and yield performances, except late in maturity. For early maturing line, Lubuk Durian x Hanafi Putih showed its potential for shallow swampland. Although this line was not the best, it showed better overall agronomic performances than the check variety. Keywords: F4 lines, growth and yield performance, rice landrace, swampland, plant maturity
Penelitian ini merupakan jenis penelitian pengembangan R&D ( Research And Development) dengan modifikasi model pengembangan 4D (Define, Design, Development dan Dessemination) yang bertujuan untuk mengembangkan LKPD berbasis problem based learning pada mata pelajaran matematika materi penjumlahan, dengan menggunakan teknik analisis data deskriptif kualitatif. Dari hasil penelitian dan pengembangan menunjukkan bahwa LKPD yang dikembangkan layak untuk digunakan berdasarkan validasi oleh ahli materi memperoleh 17 kategori penilaian ‘‘Ya’’ dari 19 pernyataan dan 2 kategori penilaian ‘‘Tidak’’ validasi oleh ahli media memberikan 14 kategori penilaian ‘‘Ya’’ dan 1 kategori penilaian ‘‘Tidak’’. Berdasarkan data yang diperoleh dapat disimpulkan bahwa pengembangan LKPD berbasis problem based learning pada mata pelajaran matematika materi penjumlahan layak digunakan. Kata Kunci: Pengembangan, LKPD, Berbasis Problem Based Learning. Penelitian ini merupakan jenis penelitian pengembangan R&D ( Research And Development) dengan modifikasi model pengembangan 4D (Define, Design, Development dan Dessemination) yang bertujuan untuk mengembangkan LKPD berbasis problem based learning pada mata pelajaran matematika materi penjumlahan, dengan menggunakan teknik analisis data deskriptif kualitatif. Dari hasil penelitian dan pengembangan menunjukkan bahwa LKPD yang dikembangkan layak untuk digunakan berdasarkan validasi oleh ahli materi memperoleh 17 kategori penilaian ‘‘Ya’’ dari 19 pernyataan dan 2 kategori penilaian ‘‘Tidak’’ validasi oleh ahli media memberikan 14 kategori penilaian ‘‘Ya’’ dan 1 kategori penilaian ‘‘Tidak’’. Berdasarkan data yang diperoleh dapat disimpulkan bahwa pengembangan LKPD berbasis problem based learning pada mata pelajaran matematika materi penjumlahan layak digunakan.
Kepemilikan harta merupakan salah satu kebutuhan dan alat pemuas dalam kehidupan manusia. Harta dibedakan antara materi dan nilai. Materi hanya bisa berwujud ketika seluruh manusia atau sebagian diantara mereka menggunakan sebagai materi, dan nilai hanya berlaku bila dibolehkan oleh ajaran syari’at. Dalam konteks kepemilikian, harta dibedakan menjadi pemilikan individu dan pemilikan secara kolektif. Disamping prinsip pemilikan dalam Islam juga diatur mengenai usaha secara islami. Pemilikan terkait erat dengan wirausaha, karena apa yang telah dihasilkan dengan usahanya itu menjadi miliknya. Oleh karena itu prinsip pemilikan tidak bisa dipisahkan dengan wirausaha
[EFFECT OF CONCENTRATION AND APPLICATION TIME OF ORGANIC FERTILIZER LIQUID BANANA PEELS ON GROWTH AND YIELD OF JAVA TEA (Orthosiphon aristatus)]. Java tea are medicinal plants that have many health benefits but java tea production is very low. Efforts are made to increase the growth and yield of java tea, namely the use of liquid organic fertilizer (LOF) banana peels. This study aims to obtain concentration, application time of LOF banana peels, and interactions between the two that produce high growth and yield of java tea. The study was conducted from November 2018 to February 2019 in the city of Bengkulu. The experiments were arranged based on a completely randomized design factorial pattern. The first factor is the LOF concentration of banana peels 25 mL/L, 50 mL/L, 75 mL/L, and 100 mL/L. The second factor is the time of LOF application which consists of 1 week application, 2 weeks application, and 3 weeks application. The results showed that independently giving concentration and application time and interaction did not significantly influence the variable thickness of leaves, total leaf area, shoot length, number of leaves, fresh plant weight, root length, and dry plant weight.
Praktek jual beli online tentunya memiliki sisi positif maupun sisi negatif karena mekanisme jual beli online yang sedikit berbeda dengan jual beli secara langsung. Keterbatasan media dalam praktik jual beli inilah yang tidak sedikit menimbulkan kerugian diantara penjual dan pembeli. Oleh karena itu dalam jual beli mensyariatkan adanya hak khiyar. Permasalahan yang diangkat dalam penelitian ini bagaimana kedudukan khiyar aib dalam jual beli online motor antik?. Jenis penelitian ini field research. Metode yang digunakan yaitu observasi, wawancara, dokumentasi. Hasil penelitian ini menyatakan bahwa kedudukan khiyar aib dalam jual beli online motor antik sudah terpenuhi. Namun untuk menentukan membeli atau tidaknya mereka menggunakan khiyar ru’yah. Sehingga bisa dikatakan bahwa jual beli online motor antik jenis CB 100 merupakan praktek yang dilarang oleh Islam. Praktek ini lebih banyak mengandung kemudharatan dibandingkan kemaslahatannya. Kendatipun secara hukum islam sah akad jual belinya. Tetapi praktek dan sistem yang digunakan bertentangan dengan aturan agama dan dilarang oleh syara’.
This research was aimed to identifying the P5CS gene involved in the drought stress mechanism in upland rice lines which is candidate as new genetic resource for breeding programs. The plant material consisted of 19 breed lines: Salumpikit and IR20 varieties, drought-tolerant and sensitive, respectively. The experiment consisted of 4 stages, including the evaluation of drought stress with 20% PEG 6000 (-0.58 MPa) in the germination and nursery phases, the vegetative phase, and the expression analysis of the P5CS gene. The results showed that the PEG inhibited the growth of roots, shoots, and the ratio of roots to shoot in the germination and nursery phases of all the tested lines, while the Salumpikit and IR20 varieties were confirmed as drought resistant and sensitive, respectively. The proline content under drought stress was significantly different in the lines tested, while Salumpikit and IR20 were confirmed to have high and low proline content, respectively. The proline content in several lines, such as G4, G6, G8, G10, G12, G13, G14, G15, and G17, exceeded the content in the Salumpikit variety. The P5CS gene was amplified in PCR analysis and expressed in the consistency of proline. It was found that the lines of G4, G6, G8, G13, and G17 showed tolerance to drought stress, had high STI values, and showed recovery ability and proline content. These lines have the potential to be released as candidates for new varieties. In addition, these lines have great potential as a new genetic source for upland rice breeding programs.
Soybean is a type of secondary crop that is widely cultivated and used as raw material for tofu, tempe, milk, and so on by the people of Indonesia. Soybean consumption is always increasing but soybean production has decreased. This study aims to obtain the optimum dose of Bokashi fertilizer on plant growth and yield in Ultisol. The study was carried out in Medan Baru, Kandang Limun Village, Muara Bangkahulu District, Bengkulu City from December 2018 to April 2019. This study used a Completely Randomized Block Design (RCBD) with one factor, namely the dose of Bokashi fertilizer with five levels, namely 0 tons ha-1, 25 tons ha-1, 35 tons ha-1, 45 tons ha-1, and 55 tons ha-1. The results showed that the optimum dose of Bokashi fertilizer was not found in the growth component or yield component. The dose of Bokashi fertilizer had a significant effect (p<0.05) on the growth of Bokashi and the number of leaves.
Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse. Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants. The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI. Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively. Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively. This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.