Here, the interaction of three aptamers with HIV-1 protease was investigated with the help of molecular dynamics simulations. These simulations led to precise structural and energetic results. The sequencing of the considered aptamers was AP1 as the aptamer number 1: (CUUCAUUGUAACUUCU-CAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU), AP2 as the aptamer number 2: (CCGGGUCGUCCCCUACGGGGACUAAAGA-CUGUGUCCAACCGCCCUCGCCU), and AP3 as the aptamer number 3: (C, U, A, G and UU nucleotides of AP1 were replaced with A, G, G, A and C to yield AP3). The results of molecular dynamics simulations showed that aptamers 2 and 3 were good alternatives to interact with the protease enzyme and to control this enzyme; however, in AP2 the results were somehow improved. The results of MM-PBSA showed that although the aptamer 3 as a mutant aptamer had a good affinity with the protease enzyme, as compared to the aptamer 1, by impairing dimerization, it disrupted its structural stability and function. However, the results also indicated that the aptamer 2 could be a better inhibitor because it would cause a more severe conformational change in the structure of the enzyme.
Here the interaction of three aptamers with HIV-1 protease has been investigated with the help of molecular dynamics simulations. These simulations lead to precise structural and energetic results. The sequencing of the considered aptamers is AP1 as the aptamer number 1: (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU), AP2 as the aptamer number 2: (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) and AP3 as the aptamer number 3: (C, U, A, C, and C nucleotides of AP1 were replaced with A, G, G, A, and C to yield AP3). The results of molecular dynamics simulations show that aptamers 2 and 3 are good alternatives to interact with the protease enzyme and to control this enzyme, but in AP2 has somewhat improved the results. The results of MM-PBSA show that although aptamer three as a mutant aptamer has a good affinity with the protease enzyme compared to aptamer one and by impairing dimerization, it disrupts its structural stability and function. However, the results indicate that aptamer 2 is a better inhibitor because it causes a more severe conformational change in the structure of the enzyme.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.