In this study, we report the first atomic resolution structure of a stable G-hairpin formed by a natively occurring DNA sequence. An 11-nt long G-rich DNA oligonucleotide, 5'-d(GTGTGGGTGTG)-3', corresponding to the most abundant sequence motif in irregular telomeric DNA from Saccharomyces cerevisiae (yeast), is demonstrated to adopt a novel type of mixed parallel/antiparallel fold-back DNA structure, which is stabilized by dynamic G:G base pairs that transit between N1-carbonyl symmetric and N1-carbonyl, N7-amino base-pairing arrangements. Although the studied sequence first appears to possess a low capacity for base pairing, it forms a thermodynamically stable structure with a rather complex topology that includes a chain reversal arrangement of the backbone in the center of the continuous G-tract and 3'-to-5' stacking of the terminal residues. The structure reveals previously unknown principles of the folding of G-rich oligonucleotides that could be applied to the prediction of natural and/or the design of artificial recognition DNA elements. The structure also demonstrates that the folding landscapes of short DNA single strands is much more complex than previously assumed.
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G‐tetrads. Three‐ or four‐tetrad G4s and antiparallel two‐tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two‐tetrad parallel‐stranded DNA G4 has never been experimentally observed. Many sequences compatible with two‐tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel‐stranded G4 upon increasing the number of GGG‐to‐GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G‐triad, whose topology depends on the location of the deletion. Removal of another guanine from another G‐tract leads to di‐ or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two‐tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two‐tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
We recently showed that Saccharomyces cerevisiae telomeric DNA can fold into an unprecedented pseudocircular G-hairpin (PGH) structure. However, the formation of PGHs in the context of extended sequences, which is a prerequisite for their function in vivo and their applications in biotechnology, has not been elucidated. Here, we show that despite its ‘circular’ nature, PGHs tolerate single-stranded (ss) protrusions. High-resolution NMR structure of a novel member of PGH family reveals the atomistic details on a junction between ssDNA and PGH unit. Identification of new sequences capable of folding into one of the two forms of PGH helped in defining minimal sequence requirements for their formation. Our time-resolved NMR data indicate a possibility that PGHs fold via a complex kinetic partitioning mechanism and suggests the existence of K+ ion-dependent PGH folding intermediates. The data not only provide an explanation of cation-type-dependent formation of PGHs, but also explain the unusually large hysteresis between PGH melting and annealing noted in our previous study. Our findings have important implications for DNA biology and nanotechnology. Overrepresentation of sequences able to form PGHs in the evolutionary-conserved regions of the human genome implies their functionally important biological role(s).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.