G‐Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Abstract

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G‐tetrads. Three‐ or four‐tetrad G4s and antiparallel two‐tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two‐tetrad parallel‐stranded DNA G4 has never been experimentally observed. Many sequences compatible with two‐tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel‐stranded G4 upon increasing the number of GGG‐to‐GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G‐triad, whose topology depends on the location of the deletion. Removal of another guanine from another G‐tract leads to di‐ or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two‐tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two‐tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Tracking Topological and Electronic Effects on the Folding and Stability of Guanine-Deficient RNA G-Quadruplexes, Engineered with a New Computational Tool for De Novo Quadruplex Folding

“…The reference sequence (PDB ID: 2RQJ, Figure 1 , Table A1 , Models 1 and 2) of the investigated series of RNA quadruplexes was GG–A–GG–A–GG–A–GG–A, i.e., had single-nucleotide adenine loops and one single-nucleotide adenine cap [ 55 ]. Except in the case of G-undecamer ( Table A1 , Model 24), where guanines from the loops caused a structural destabilization by strongly interfering with G-tetrads, all investigated GQ topologies with single-nucleotide loops and no cap fragments remained stable ( Table A1 , Models 16, 24–26), in agreement with previous reports [ 12 , 55 ]. The presence of at least one single-nucleotide cap substantially enhanced the stability of all those GQ structures (e.g., even a G-undecamer quadruplex with one A-cap remained stable, Table A1 , Model 5), primarily through retaining the central cation inside the GQ core, but also by contributing to the stabilizing pi-stacking interactions with the G-tetrad residues ( Table A1 , Models 2–6).…”

“…For example, the shortest, single-nucleotide loops intrinsically form the propeller geometry, which corresponds to the parallel orientation of the four G-strands that are inherent in RNA G-quadruplexes. The combination of different loop geometries, orientations of G-strands and molecularities determines the polymorphism of GQs [ 9 ], with 26 theoretically possible G-quadruplex topologies for nucleic acids, among which only a few have been observed in vitro [ 10 , 11 , 12 ]. Ultimately, the topology of a G-quadruplex depends on its precise nucleotide sequence, which can provide additional stabilizing interactions via pi-stacking, hydrogen bonding, solvation and cation coordination, but also on buffer conditions, i.e., the types of cations in the solvent.…”

Exploring Sequence Space to Design Controllable G-Quadruplex Topology Switches

“…While direct experimental detection of this species would be quite challenging given its transient nature, this assumption is consistent with recent MD simulations of diverse truncated G4 structures and folding intermediates 76 and experimental and theoretical data acquired for sequences able to form two-quartet G4s only. 77 The available experimental and theoretical data thus provide a solid indirect evidence that allows to construct the kinetic model explaining our experimental observations (more details and discussion are shown in Supporting Information Figure S12).…”

Controlling the G-Quadruplex Topology: Toward the Formation of a Lipid Thrombin Binding Aptamer Prodrug

“…In our case, the high thermal stability observed for the parallel G4 formed from K-(PC-)TBA would suggest the formation of a multimeric structure. Indeed, intramolecular two-tetrad parallel G4s are not thermodynamically stable as demonstrated recently by Mergny et al 47,48 Formation of dimers or alternative multimeric species are therefore necessary to expand the number of G-tetrad stacks that ultimately provide sufficient stabilization energy to the overall self-assembly. 49,50 As a consequence, two TBA strands at the very least are poised to interact in the final parallel folds at high ionic strength in our case.…”