IMGT/V-QUEST is the highly customized and integrated system for the standardized analysis of the immunoglobulin (IG) and T cell receptor (TR) rearranged nucleotide sequences. IMGT/V-QUEST identifies the variable (V), diversity (D) and joining (J) genes and alleles by alignment with the germline IG and TR gene and allele sequences of the IMGT reference directory. New functionalities were added through a complete rewrite in Java. IMGT/V-QUEST analyses batches of sequences (up to 50) in a single run. IMGT/V-QUEST describes the V-REGION mutations and identifies the hot spot positions in the closest germline V gene. IMGT/V-QUEST can detect insertions and deletions in the submitted sequences by reference to the IMGT unique numbering. IMGT/V-QUEST integrates IMGT/JunctionAnalysis for a detailed analysis of the V-J and V-D-J junctions, and IMGT/Automat for a full V-J- and V-D-J-REGION annotation. IMGT/V-QUEST displays, in ‘Detailed view’, the results and alignments for each submitted sequence individually and, in ‘Synthesis view’, the alignments of the sequences that, in a given run, express the same V gene and allele. The ‘Advanced parameters’ allow to modify default parameters used by IMGT/V-QUEST and IMGT/JunctionAnalysis according to the users’ interest. IMGT/V-QUEST is freely available for academic research at http://imgt.cines.fr

IMGT, the international ImMunoGeneTics database (http://imgt.cines.fr) is a high quality integrated information system specializing in immunoglobulins (IG), T cell receptors (TR) and major histocompatibility complex (MHC) of human and other vertebrates. IMGT provides a common access to expertly annotated data on the genome, proteome, genetics and structure of the IG and TR, based on the IMGT Scientific chart and IMGT-ONTOLOGY. The IMGT unique numbering defined for the IG and TR variable regions and domains of all jawed vertebrates has allowed a redefinition of the limits of the framework (FR-IMGT) and complementarity determining regions (CDR-IMGT), leading, for the first time, to a standardized description of mutations, allelic polymorphisms, 2D representations (Colliers de Perles) and 3D structures, whatever the antigen receptor, the chain type, or the species. The IMGT numbering has been extended to the V-like domain and is, therefore, highly valuable for comparative analysis and evolution studies of proteins belonging to the IG superfamily.

IMGT®, the international ImMunoGeneTics information system® (http://www.imgt.org), was created in 1989 by Marie-Paule Lefranc, Laboratoire d'ImmunoGénétique Moléculaire LIGM (Université Montpellier 2 and CNRS) at Montpellier, France, in order to standardize and manage the complexity of immunogenetics data. The building of a unique ontology, IMGT-ONTOLOGY, has made IMGT® the global reference in immunogenetics and immunoinformatics. IMGT® is a high-quality integrated knowledge resource specialized in the immunoglobulins or antibodies, T cell receptors, major histocompatibility complex, of human and other vertebrate species, proteins of the IgSF and MhcSF, and related proteins of the immune systems of any species. IMGT® provides a common access to standardized data from genome, proteome, genetics and 3D structures. IMGT® consists of five databases (IMGT/LIGM-DB, IMGT/GENE-DB, IMGT/3Dstructure-DB, etc.), fifteen interactive online tools for sequence, genome and 3D structure analysis, and more than 10 000 HTML pages of synthesis and knowledge. IMGT® is used in medical research (autoimmune diseases, infectious diseases, AIDS, leukemias, lymphomas and myelomas), veterinary research, biotechnology related to antibody engineering (phage displays, combinatorial libraries, chimeric, humanized and human antibodies), diagnostics (clonalities, detection and follow-up of residual diseases) and therapeutical approaches (graft, immunotherapy, vaccinology). IMGT is freely available at http://www.imgt.org.

No abstract

IMGT®, the international ImMunoGeneTics information system®(http://www.imgt.org) is the global reference in immunogenetics and immunoinformatics. By its creation in 1989 by Marie-Paule Lefranc (Université de Montpellier and CNRS), IMGT® marked the advent of immunoinformatics, which emerged at the interface between immunogenetics and bioinformatics. IMGT® is specialized in the immunoglobulins (IG) or antibodies, T cell receptors (TR), major histocompatibility (MH) and proteins of the IgSF and MhSF superfamilies. IMGT® is built on the IMGT-ONTOLOGY axioms and concepts, which bridged the gap between genes, sequences and 3D structures. The concepts include the IMGT® standardized keywords (identification), IMGT® standardized labels (description), IMGT® standardized nomenclature (classification), IMGT unique numbering and IMGT Colliers de Perles (numerotation). IMGT® comprises 7 databases, 17 online tools and 15 000 pages of web resources, and provides a high-quality and integrated system for analysis of the genomic and expressed IG and TR repertoire of the adaptive immune responses, including NGS high-throughput data. Tools and databases are used in basic, veterinary and medical research, in clinical applications (mutation analysis in leukemia and lymphoma) and in antibody engineering and humanization. The IMGT/mAb-DB interface was developed for therapeutic antibodies and fusion proteins for immunological applications (FPIA). IMGT® is freely available at http://www.imgt.org.

No abstract

also in IMGT booklet with generous provision from Cold Spring Harbor (CSH) Protocols (high res) (lower res) Species Homo sapiens (human) Receptor type or locus IGH IMGT directory reference set F+ORF+ in-frame P Search for insertions and deletions yes A. Detailed results for the IMGT/V-QUEST analysed sequences Number of analysed sequences: 1 1. sequence This release of IMGT/V-QUEST uses IMGT/JunctionAnalysis for the analysis of the JUNCTION Hyphens (-) show nucleotide identity, dots (.) represent gaps Sequence: 1 sequence Analysed sequence length: 288. Sequence analysis category: 2 (indel search & correction). Sequence compared with the Homo sapiens (human) IG set from the IMGT reference directory >sequence caggtgcagctgcaggaaagcggcccgggcctggtgaaaccgagcgaaaccctgagcctg acctgcaccgtgagcggcggcagcattagcagctattattggagctggattcgccagccg gcgggcaaaggcctggaatggattggccgcatttttgcgagcggcaacaccaactataac ccgagcctGcgcgaaagcagccatcatTgccagcagacccgcccgcgcaccagcagcccg agCaaactgagcagcgtgaccgcggcggataccgcggtgtattattgc

INTRODUCTIONIMGT, the international ImMunoGeneTics information system (http://www.imgt.org), created in 1989 by the Laboratoire d’ImmunoGénétique Moléculaire LIGM (Université Montpellier 2 and CNRS, Montpellier, France), is the global reference in immunogenetics and immunoinformatics. IMGT-ONTOLOGY concepts, generated from the Formal IMGT-ONTOLOGY or IMGT-Kaleidoscope axioms, have allowed us to set up the IMGT Scientific chart rules and to standardize and manage the complexity of immunogenetics data. IMGT is a high-quality integrated knowledge resource specializing in the immunoglobulins (IG) or antibodies, T cell receptors (TR), and major histocompatibility (MH) of human and other vertebrate species, proteins of the immunoglobulin superfamily (IgSF) and MH superfamily (MhSF), related proteins of the immune systems (RPI) of vertebrates and invertebrates, therapeutic monoclonal antibodies (mAb), and fusion proteins for immune applications (FPIA). IMGT provides a common access to standardized data from genome, proteome, genetics, and three-dimensional (3D) structures. IMGT consists of databases, interactive online tools, and Web resources.